miRTarBase - #MIRT539231


—
pre-miRNA Information
pre-miRNA hsa-mir-367   
Genomic Coordinates chr4: 112647874 - 112647941
Synonyms MIRN367, hsa-mir-367, MIR367
Description Homo sapiens miR-367 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-367-3p
Sequence 44| AAUUGCACUUUAGCAAUGGUGA |65
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN24411246 17 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs535597757 1 dbSNP
rs1013348949 11 dbSNP
rs896333735 12 dbSNP
rs751269136 14 dbSNP
rs1163501507 16 dbSNP
rs757092597 21 dbSNP
Putative Targets

Gene Information
Gene Symbol ANP32E   
Synonyms LANP-L, LANPL
Description acidic nuclear phosphoprotein 32 family member E
Transcript NM_001136478   
Other Transcripts NM_001136479 , NM_030920   
Expression
Putative miRNA Targets on ANP32E
3'UTR of ANP32E
(miRNA target sites are highlighted)		 
>ANP32E|NM_001136478|3'UTR
   1 ATCATTCTAAGACCAGATTCTCTAATGTTTCTGGGTGTGCAATAGAGTGATCACATCTTTGTTTCTTCATGTACGATAGC
  81 TATCCCTACAGAAGATAATGTGTAACTTTTTATAGGAAAAGTGTGGTTTTACTATTTTTGCCTTATCATTCCAAATAAGA
 161 ACTAGTCTGTTAATGATCATATTGTATGTAGAGAAAAATTTTCATTGACTCCCATTGTGGAATTCCCTAGCAATTTATTT
 241 AGACTTAATTTTTTAAATTCAAGCTTACTGTATTAGTCATTTTTAGCCCATAATTAAAACATGATCACTTTTACACAGGT
 321 GTAGTATGGTGCATTTCATTCCTTATTTATAAATTAACTGAAATTACAGTTTGCTATAATATAAAATGACAATAGTCTCT
 401 TGAGTGGTAAGTTGGTTATTTTTTTAGAGGTGATCCAGGAATCTTTAGTTTGAAGGCAGTTACCTTTTTTTTTTTTTTTT
 481 TTTGACTAAGAGTGTTTGGTTGCTTTTTTGTCACAAGTAACTTGGAAAATAGAAGCAGAATAGTAAAGGTTCTATTCAGC
 561 AACATAGTTCATGGATTTTGTGGAGGTTCTATTCAGTAATATGGTTCATGGATTTAGTGGTGACTGATAAGATTTTATTT
 641 TTGAAGGAAAAATTGCTTATACTAAGTCCAGAGACATGCAGGTGAGCCCTTTTGTCAGGCTGCAAATCATGACATGCCGA
 721 TGGTTGTTTATTTTGTTTTTAGGTGTGCATTCTTTTTCTTCTTAGCAATTCCTTTATGATCACCTTCCCTTCTTGTTTCA
 801 CTCCCTCCCGCTCTCTCAAAAGGAACTTGGGAAACTTGTGAAACCCAGGAAAACCTTTAGTCTTATACCTCAACTACCTT
 881 TCAGTCCTGTCTGGGTTTTAAATAAGTGAAGTAGAAGAAATTGAGTATTTTCTGACATAAGAATATATTATCAATACAGT
 961 TTTATGCAGTAAGCTCTCCTTACCATAAATGTTTCTTGGTTGACAACATCTAAGACAATATTAGTGGGATGAAGAAAGAA
1041 AAGCAGGGGTGCTTTTGGAAGCAGTGTTAGTGTTCCTCAAAAGTCGGAACAATTGCCTGTTGATATATTAATAAGACATT
1121 AAAGTCAAATTTTAATGTTGGCCTCTCAAATGATTTGGATACCACTCTGCAAAGTATTTCTAACCTTTAATTCCCAGTTT
1201 TAAAACAGATATAATAATAGCATTTAATTGGAATATACTAGGCAGCTGGAAAAGTATTTGAAACTAAATTGACATTAAAA
1281 TTAAGATTTGTTTTCAAGTGGATGTCCATTAAAAGTAGAAAAATATTTGGGATAAGTGAGTGTGTGTTTCCTTACATGGC
1361 TACTAAATAAAATATAATGAGTATACAAGTATATCTCCTCTTTTGCTATGGAGGCTCCATGTTCAAGGCAATGGCTTTTT
1441 AAATCTTGGCTATCTAAAATTTTTTCCCTTTGTTTTGAATATTTGTAAGTTTTTAAGAAGTTAGTGTCAGCAAATTAATT
1521 GAAGTTATGCTTCTATACTGGGACATATTTAAATACTGAGTATAGTACTGCTGCTACTGCTTCTACAATGTAAAATGTAT
1601 GACTTGGTGTTTTAAAGTAAAAATTATGATGTTACTTGTGGAGAAACTAAAAATGTTGTACAACTGACCGAAAGAAAACC
1681 CTTGGGGATAAGTTTAGTGAGGGGATTGGAATCCCCAAAAAGATAACATTTTTCTTCTGCTTTTAAAAACTGAAATTCCC
1761 TGTTCTAGTTCCTAACAATTCTCATTACATACTATGCCAGATTACAAAATACTTATTTTTAAAATGAAATCTATATATTG
1841 ACTTTCTTATCAATCATCTTACTGTGCAATCAAAATTAGAGTACTTTGGTTTGAAAACAACACTTAGAGCCTCCAGATAA
1921 CTTTTAAGACTTATTTAGCTTTGTGGGTGGTATTTTCATGCAAATAAGTAAGGGTGGGTTTTATATTTTGTAGAAGTTTT
2001 CGGTCCTATTTTAATGCTCTTTGTATGGCAGTATGTATATATTGTGTTAAGTTCCTCAAGAATCTCCTTAAAAACTTTGA
2081 AGTTAATACTTTTGTGCAACTGTGTTTTGAATAAAGCCATGACAGTGTTAAAAACAAACAAAAAAATTTGCAGTACTCCT
2161 GATTATTCTTTTATTGTTTTTGACTGTTCCCTGTTTTTTTCTGTGACTGCTGTAACTTAAAGTTTTTGAAACTGAATTGC
2241 TTCAAATAAATTGAAGATTTGTTATAATGATTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agUGGUAACGAUUU-CACGUUAa 5'
            | ::|| ||::: ||||||| 
Target 5' ctAATGTTTCTGGGTGTGCAATa 3'
 22 - 44 156.00 -9.00
2 
miRNA  3' agUGGUAACGAUUUCACGUUAa 5'
            |:|| | :||  ||||||| 
Target 5' caATCA-TCTTACTGTGCAATc 3'
 1851 - 1871 155.00 -10.00
3 
miRNA  3' agUGGUAACGAUUUCACGUUaa 5'
            :::| | ||   ||||||  
Target 5' aaGTTAATACTTTTGTGCAAct 3'
 2080 - 2101 128.00 -6.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30146944 22 COSMIC
COSN26571178 40 COSMIC
COSN31504813 49 COSMIC
COSN30516710 75 COSMIC
COSN31514827 81 COSMIC
COSN30482250 85 COSMIC
COSN30499063 87 COSMIC
COSN30532688 88 COSMIC
COSN8636160 146 COSMIC
COSN30178037 156 COSMIC
COSN31574409 159 COSMIC
COSN26787866 179 COSMIC
COSN31580981 189 COSMIC
COSN1405688 221 COSMIC
COSN31550598 309 COSMIC
COSN9363068 337 COSMIC
COSN29468357 341 COSMIC
COSN1405687 389 COSMIC
COSN26583836 390 COSMIC
COSN26642094 390 COSMIC
COSN31546144 408 COSMIC
COSN31607436 423 COSMIC
COSN25609922 511 COSMIC
COSN31533591 531 COSMIC
COSN31546753 539 COSMIC
COSN17037504 632 COSMIC
COSN16310597 1053 COSMIC
COSN26829572 1162 COSMIC
COSN22837835 1718 COSMIC
COSN19147305 2009 COSMIC
COSN22160342 2076 COSMIC
COSN30540190 2084 COSMIC
COSN31588742 2101 COSMIC
COSN31540732 2109 COSMIC
COSN31611104 2263 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1455914389 1 dbSNP
rs1320489974 2 dbSNP
rs782818937 8 dbSNP
rs782144349 9 dbSNP
rs1452815761 10 dbSNP
rs1304058672 14 dbSNP
rs781941884 17 dbSNP
rs782314654 22 dbSNP
rs782105871 26 dbSNP
rs781961799 30 dbSNP
rs1227417396 31 dbSNP
rs782400147 34 dbSNP
rs782250445 37 dbSNP
rs782081551 39 dbSNP
rs782703817 43 dbSNP
rs782170800 47 dbSNP
rs1330971305 57 dbSNP
rs1226336657 66 dbSNP
rs903637885 68 dbSNP
rs1267504315 70 dbSNP
rs142580858 74 dbSNP
rs945061569 82 dbSNP
rs896171819 84 dbSNP
rs1235824210 96 dbSNP
rs1482942988 103 dbSNP
rs1056756709 104 dbSNP
rs1177998912 119 dbSNP
rs587637181 132 dbSNP
rs1410365121 137 dbSNP
rs1471847368 156 dbSNP
rs937952842 164 dbSNP
rs1158886155 167 dbSNP
rs1430660817 177 dbSNP
rs1174526340 181 dbSNP
rs1356936072 184 dbSNP
rs1446575705 191 dbSNP
rs1298451483 199 dbSNP
rs926421626 204 dbSNP
rs782333196 209 dbSNP
rs973918912 212 dbSNP
rs1323926230 244 dbSNP
rs1220902496 248 dbSNP
rs1276333198 255 dbSNP
rs1311692826 257 dbSNP
rs1205290557 270 dbSNP
rs782220151 276 dbSNP
rs587767203 301 dbSNP
rs1254326790 320 dbSNP
rs1482178595 328 dbSNP
rs1181671176 335 dbSNP
rs908654613 338 dbSNP
rs1270093157 339 dbSNP
rs1481586408 342 dbSNP
rs1189998276 344 dbSNP
rs147715673 348 dbSNP
rs1425069494 350 dbSNP
rs587616202 352 dbSNP
rs1170501841 355 dbSNP
rs955524756 359 dbSNP
rs1427442590 376 dbSNP
rs782618382 380 dbSNP
rs1306976658 382 dbSNP
rs782471739 386 dbSNP
rs1345914731 387 dbSNP
rs1438271618 389 dbSNP
rs587767591 394 dbSNP
rs372954380 406 dbSNP
rs1276835381 407 dbSNP
rs976030288 409 dbSNP
rs775656829 415 dbSNP
rs1204710166 418 dbSNP
rs1033168980 419 dbSNP
rs1448321110 429 dbSNP
rs1197198646 430 dbSNP
rs1246682042 433 dbSNP
rs1476016594 439 dbSNP
rs1191002963 444 dbSNP
rs587685847 449 dbSNP
rs770178713 461 dbSNP
rs1391509628 464 dbSNP
rs1447056124 465 dbSNP
rs1167584639 479 dbSNP
rs1365795245 482 dbSNP
rs868988665 482 dbSNP
rs1289649119 485 dbSNP
rs1299645776 485 dbSNP
rs1321302662 485 dbSNP
rs1349274544 485 dbSNP
rs1363135604 485 dbSNP
rs1406941407 485 dbSNP
rs1431432855 485 dbSNP
rs1447896474 485 dbSNP
rs1211126905 486 dbSNP
rs145934219 491 dbSNP
rs1246663990 494 dbSNP
rs370955710 496 dbSNP
rs1463204343 500 dbSNP
rs1187385185 511 dbSNP
rs782045947 511 dbSNP
rs1368722861 513 dbSNP
rs118146983 521 dbSNP
rs6679147 541 dbSNP
rs1412808242 542 dbSNP
rs1457522204 546 dbSNP
rs1322538586 550 dbSNP
rs1386357546 555 dbSNP
rs1434520425 558 dbSNP
rs1337447589 564 dbSNP
rs782245698 578 dbSNP
rs1342297801 581 dbSNP
rs1242918106 587 dbSNP
rs1021100617 597 dbSNP
rs1283746144 606 dbSNP
rs1009331921 607 dbSNP
rs1230604102 611 dbSNP
rs1266852875 613 dbSNP
rs896106441 620 dbSNP
rs1207610913 622 dbSNP
rs1256270322 628 dbSNP
rs1443577073 634 dbSNP
rs782764551 656 dbSNP
rs1236524965 667 dbSNP
rs1472834978 679 dbSNP
rs1161070335 681 dbSNP
rs1409732122 687 dbSNP
rs587672294 718 dbSNP
rs1456664212 719 dbSNP
rs782251222 720 dbSNP
rs1404443598 721 dbSNP
rs1394301772 722 dbSNP
rs1333822328 724 dbSNP
rs937925455 729 dbSNP
rs1412107911 736 dbSNP
rs1286824205 741 dbSNP
rs1328852097 743 dbSNP
rs1224697485 765 dbSNP
rs1258226277 767 dbSNP
rs587608801 768 dbSNP
rs905153945 769 dbSNP
rs1198229025 773 dbSNP
rs1277526657 796 dbSNP
rs1483167471 805 dbSNP
rs782669280 806 dbSNP
rs1183837351 810 dbSNP
rs1249392793 811 dbSNP
rs587768263 820 dbSNP
rs1199504715 821 dbSNP
rs1379281320 823 dbSNP
rs1464664667 827 dbSNP
rs1172038050 829 dbSNP
rs941172216 832 dbSNP
rs1431885773 840 dbSNP
rs587686946 850 dbSNP
rs1350271500 860 dbSNP
rs1387696316 863 dbSNP
rs1304139429 869 dbSNP
rs587631758 870 dbSNP
rs147121925 879 dbSNP
rs1273759338 893 dbSNP
rs1342206824 905 dbSNP
rs587669830 907 dbSNP
rs1206863518 928 dbSNP
rs587599062 938 dbSNP
rs1482637437 947 dbSNP
rs1210205758 955 dbSNP
rs186412915 961 dbSNP
rs1431344776 986 dbSNP
rs1198021296 987 dbSNP
rs1390899060 996 dbSNP
rs975472066 1000 dbSNP
rs1451336053 1004 dbSNP
rs587642495 1019 dbSNP
rs1370181055 1026 dbSNP
rs1458774100 1029 dbSNP
rs964275576 1030 dbSNP
rs80110309 1031 dbSNP
rs1388966769 1044 dbSNP
rs1386740256 1048 dbSNP
rs979028516 1049 dbSNP
rs967510179 1051 dbSNP
rs782472308 1052 dbSNP
rs1365316984 1065 dbSNP
rs781839052 1067 dbSNP
rs1229951808 1081 dbSNP
rs1009693531 1086 dbSNP
rs1340979350 1087 dbSNP
rs1267016040 1107 dbSNP
rs111859228 1114 dbSNP
rs1035092222 1119 dbSNP
rs1209170499 1121 dbSNP
rs1248553792 1126 dbSNP
rs1466363636 1141 dbSNP
rs1186721466 1144 dbSNP
rs1389837951 1152 dbSNP
rs1424640617 1167 dbSNP
rs1001855552 1181 dbSNP
rs904885405 1185 dbSNP
rs1367094697 1188 dbSNP
rs1457673513 1192 dbSNP
rs1436694161 1194 dbSNP
rs1317929574 1212 dbSNP
rs782623283 1213 dbSNP
rs1360601370 1216 dbSNP
rs1396279251 1228 dbSNP
rs1038220827 1270 dbSNP
rs1319718500 1275 dbSNP
rs1232453202 1283 dbSNP
rs1331106532 1291 dbSNP
rs1206691290 1312 dbSNP
rs1247529692 1318 dbSNP
rs1483582836 1330 dbSNP
rs782770455 1338 dbSNP
rs1183834202 1339 dbSNP
rs1254326096 1343 dbSNP
rs1423659481 1347 dbSNP
rs1160318734 1348 dbSNP
rs1414895094 1349 dbSNP
rs1456130790 1356 dbSNP
rs1159021657 1358 dbSNP
rs1344095988 1370 dbSNP
rs35516778 1372 dbSNP
rs1448049739 1375 dbSNP
rs1005430509 1391 dbSNP
rs782147216 1394 dbSNP
rs149153823 1398 dbSNP
rs375389811 1398 dbSNP
rs587640758 1403 dbSNP
rs1288775398 1406 dbSNP
rs1352053749 1409 dbSNP
rs782330445 1416 dbSNP
rs1283395740 1431 dbSNP
rs1312903711 1438 dbSNP
rs1212337184 1455 dbSNP
rs182816772 1460 dbSNP
rs1254531554 1476 dbSNP
rs934062257 1484 dbSNP
rs1183109506 1486 dbSNP
rs190688581 1489 dbSNP
rs1471777825 1506 dbSNP
rs1182108228 1512 dbSNP
rs587643148 1525 dbSNP
rs1414584089 1530 dbSNP
rs1177575289 1550 dbSNP
rs587749829 1556 dbSNP
rs1040091798 1558 dbSNP
rs1356883472 1561 dbSNP
rs1433746129 1566 dbSNP
rs1308187534 1575 dbSNP
rs1372188681 1577 dbSNP
rs1407748363 1585 dbSNP
rs1278951483 1589 dbSNP
rs1368179811 1595 dbSNP
rs1221066942 1596 dbSNP
rs942654414 1607 dbSNP
rs1299313731 1610 dbSNP
rs1347195842 1613 dbSNP
rs1206145027 1619 dbSNP
rs587695652 1620 dbSNP
rs868969315 1625 dbSNP
rs114811641 1627 dbSNP
rs1482312616 1659 dbSNP
rs978974754 1664 dbSNP
rs186321795 1665 dbSNP
rs913390021 1670 dbSNP
rs1189942138 1671 dbSNP
rs993047947 1675 dbSNP
rs781955735 1683 dbSNP
rs1453204209 1685 dbSNP
rs782366466 1688 dbSNP
rs1001920898 1694 dbSNP
rs1372013162 1698 dbSNP
rs968989485 1717 dbSNP
rs1427631416 1718 dbSNP
rs36050205 1723 dbSNP
rs782238593 1724 dbSNP
rs1350205925 1735 dbSNP
rs1005422246 1741 dbSNP
rs1438565548 1750 dbSNP
rs887064962 1758 dbSNP
rs1047322897 1762 dbSNP
rs1291648299 1763 dbSNP
rs1370358883 1768 dbSNP
rs1229216596 1769 dbSNP
rs998052018 1773 dbSNP
rs181404714 1777 dbSNP
rs1214153529 1813 dbSNP
rs1039783083 1817 dbSNP
rs1453615464 1824 dbSNP
rs1220016682 1825 dbSNP
rs1252903913 1831 dbSNP
rs942770322 1834 dbSNP
rs188989339 1854 dbSNP
rs904485540 1859 dbSNP
rs1188603161 1863 dbSNP
rs1043120327 1890 dbSNP
rs946275149 1893 dbSNP
rs1474237589 1894 dbSNP
rs1166921491 1902 dbSNP
rs1414264800 1912 dbSNP
rs1406820568 1917 dbSNP
rs587753965 1930 dbSNP
rs1393637018 1954 dbSNP
rs587676259 1960 dbSNP
rs993389353 1962 dbSNP
rs938833302 1966 dbSNP
rs1322669028 1969 dbSNP
rs1363069278 1970 dbSNP
rs1430281903 1977 dbSNP
rs1284940671 1978 dbSNP
rs587598367 1984 dbSNP
rs1358971378 1994 dbSNP
rs1273148866 2002 dbSNP
rs980447918 2003 dbSNP
rs1211076379 2021 dbSNP
rs1249385076 2023 dbSNP
rs1444713785 2034 dbSNP
rs1192043909 2038 dbSNP
rs969148260 2051 dbSNP
rs1473694541 2067 dbSNP
rs1162491491 2071 dbSNP
rs1016546267 2076 dbSNP
rs1416834980 2078 dbSNP
rs587729277 2083 dbSNP
rs1457732118 2093 dbSNP
rs1161198160 2094 dbSNP
rs1382897840 2095 dbSNP
rs1400176681 2096 dbSNP
rs369383815 2122 dbSNP
rs781868576 2124 dbSNP
rs1335179895 2125 dbSNP
rs1342452130 2126 dbSNP
rs1446341514 2127 dbSNP
rs1293091338 2139 dbSNP
rs1025535705 2140 dbSNP
rs587665940 2142 dbSNP
rs1230782803 2145 dbSNP
rs1266721718 2148 dbSNP
rs900972097 2148 dbSNP
rs1204033111 2149 dbSNP
rs1278943681 2150 dbSNP
rs782050887 2159 dbSNP
rs1185294794 2176 dbSNP
rs1256544379 2177 dbSNP
rs12743568 2188 dbSNP
rs1472762107 2191 dbSNP
rs1184327436 2194 dbSNP
rs1361987824 2198 dbSNP
rs1469725038 2200 dbSNP
rs1173208788 2202 dbSNP
rs1404388017 2204 dbSNP
rs1018123484 2217 dbSNP
rs1312434328 2222 dbSNP
rs1371575314 2233 dbSNP
rs1412050954 2239 dbSNP
rs1287080066 2240 dbSNP
rs1335653282 2246 dbSNP
rs1237765294 2247 dbSNP
rs1274958293 2252 dbSNP
rs1346424111 2254 dbSNP
rs781994513 2258 dbSNP
rs904644120 2264 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agUGGUAACGAUUUCACGUUAa 5'
            |:|| | :||  ||||||| 
Target 5' caAUCA-UCUUACUGUGCAAUc 3'
 		11 - 31
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 81611.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 81611.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000533654.1 | 3UTR | ACUUUCUUAUCAAUCAUCUUACUGUGCAAUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000533654.1 | 3UTR | ACUUUCUUAUCAAUCAUCUUACUGUGCAAUCAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000533654.1 | 3UTR | GACUUUCUUAUCAAUCAUCUUACUGUGCAAUCAAAAUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000533654.1 | 3UTR | ACUUUCUUAUCAAUCAUCUUACUGUGCAAUCAAAAUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000533654.1 | 3UTR | ACUUUCUUAUCAAUCAUCUUACUGUGCAAUCAAAAUUAGAGUACUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.484 9.6e-3 0.539 4.0e-3 23 Click to see details
GSE28260 Renal cortex and medulla 0.622 1.2e-2 0.570 2.1e-2 13 Click to see details
GSE28544 Breast cancer -0.411 2.3e-2 -0.459 1.2e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.315 6.3e-2 0.431 1.6e-2 25 Click to see details
GSE32688 Pancreatic cancer 0.266 7.1e-2 0.224 1.1e-1 32 Click to see details
GSE17306 Multiple myeloma -0.204 8.0e-2 0.316 1.3e-2 49 Click to see details
GSE38226 Liver fibrosis 0.295 9.7e-2 -0.195 2.0e-1 21 Click to see details
GSE17498 Multiple myeloma -0.174 1.4e-1 -0.203 1.0e-1 40 Click to see details
GSE21849 B cell lymphoma -0.182 1.7e-1 -0.177 1.8e-1 29 Click to see details
GSE14794 Lymphoblastoid cells 0.099 1.8e-1 0.078 2.3e-1 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.13 2.9e-1 -0.108 3.3e-1 20 Click to see details
GSE27834 Pluripotent stem cells -0.147 2.9e-1 -0.265 1.6e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.081 3.5e-1 -0.096 3.3e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.184 3.8e-1 0.500 2.0e-1 5 Click to see details
GSE21687 Ependynoma primary tumors 0.02 4.4e-1 0.007 4.8e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.014 4.8e-1 0.140 3.3e-1 12 Click to see details
GSE19350 CNS germ cell tumors -0.014 4.8e-1 0.140 3.3e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
255 hsa-miR-367-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055315 DUSP5 dual specificity phosphatase 5 2 8
MIRT055791 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT057114 DDIT4 DNA damage inducible transcript 4 2 4
MIRT059663 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT059926 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT061610 BTG2 BTG anti-proliferation factor 2 2 6
MIRT066478 HMGA2 high mobility group AT-hook 2 2 2
MIRT069388 ZFYVE21 zinc finger FYVE-type containing 21 2 2
MIRT069972 GEMIN2 gem nuclear organelle associated protein 2 2 2
MIRT074764 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT076199 GID4 GID complex subunit 4 homolog 2 6
MIRT077512 UBE2Z ubiquitin conjugating enzyme E2 Z 2 4
MIRT077903 TOB1 transducer of ERBB2, 1 2 6
MIRT082250 MED29 mediator complex subunit 29 2 4
MIRT082434 CIC capicua transcriptional repressor 2 6
MIRT082474 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT082778 ZNF264 zinc finger protein 264 2 2
MIRT084533 BCL2L11 BCL2 like 11 2 8
MIRT085309 UBXN4 UBX domain protein 4 2 8
MIRT086365 SSFA2 sperm specific antigen 2 2 8
MIRT087455 NF2 neurofibromin 2 2 2
MIRT088865 FOXN2 forkhead box N2 2 12
MIRT092185 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 6
MIRT092326 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 6
MIRT093533 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT096935 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 8
MIRT097026 MAP1B microtubule associated protein 1B 2 4
MIRT099137 MYLIP myosin regulatory light chain interacting protein 2 6
MIRT099905 SOX4 SRY-box 4 2 12
MIRT102289 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT102507 KLHDC10 kelch domain containing 10 2 2
MIRT102891 INSIG1 insulin induced gene 1 2 2
MIRT109188 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT124567 PRRC2B proline rich coiled-coil 2B 2 2
MIRT135568 SPRYD4 SPRY domain containing 4 2 2
MIRT161135 SLC25A36 solute carrier family 25 member 36 2 6
MIRT163995 KIAA1109 KIAA1109 2 4
MIRT164689 RNF4 ring finger protein 4 2 2
MIRT167705 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 2 8
MIRT178956 USP28 ubiquitin specific peptidase 28 2 2
MIRT185717 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT186264 TCEB3 elongin A 2 2
MIRT186537 TWF1 twinfilin actin binding protein 1 2 4
MIRT186628 COX20 COX20, cytochrome c oxidase assembly factor 2 8
MIRT189373 TXLNA taxilin alpha 2 4
MIRT197013 EIF1 eukaryotic translation initiation factor 1 2 10
MIRT206437 YIPF4 Yip1 domain family member 4 2 2
MIRT211228 FGF2 fibroblast growth factor 2 2 10
MIRT214529 C5ORF24 chromosome 5 open reading frame 24 2 2
MIRT216034 IL6ST interleukin 6 signal transducer 2 10
MIRT218084 TULP4 tubby like protein 4 2 2
MIRT242418 CCDC113 coiled-coil domain containing 113 2 2
MIRT243162 SOX11 SRY-box 11 2 2
MIRT250943 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT253350 ZNF417 zinc finger protein 417 2 2
MIRT271968 ARF1 ADP ribosylation factor 1 2 2
MIRT273214 ZNF695 zinc finger protein 695 2 4
MIRT296114 SLC12A5 solute carrier family 12 member 5 2 2
MIRT301711 TEF TEF, PAR bZIP transcription factor 2 2
MIRT316477 ARID1B AT-rich interaction domain 1B 2 6
MIRT322174 CLN8 CLN8, transmembrane ER and ERGIC protein 2 4
MIRT341538 CNIH1 cornichon family AMPA receptor auxiliary protein 1 2 6
MIRT356062 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT443579 PPIC peptidylprolyl isomerase C 2 2
MIRT448825 FKBP1A FK506 binding protein 1A 2 4
MIRT451494 FOPNL FGFR1OP N-terminal like 2 2
MIRT452694 MDM2 MDM2 proto-oncogene 2 2
MIRT453167 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT454588 SLC33A1 solute carrier family 33 member 1 2 4
MIRT455794 TAF8 TATA-box binding protein associated factor 8 2 4
MIRT456010 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456044 KIAA1586 KIAA1586 2 2
MIRT456763 TMEM239 transmembrane protein 239 2 4
MIRT458068 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT459230 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT459534 MFF mitochondrial fission factor 2 6
MIRT459759 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT460236 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT461104 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT462924 ZNRF3 zinc and ring finger 3 2 2
MIRT463476 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463516 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT465503 TOR1B torsin family 1 member B 2 2
MIRT469525 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT470079 PTGES2 prostaglandin E synthase 2 2 2
MIRT471581 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT473451 MCOLN2 mucolipin 2 2 8
MIRT475882 H3F3C H3 histone family member 3C 2 10
MIRT475915 H3F3B H3 histone family member 3B 2 8
MIRT476195 GOLGA8A golgin A8 family member A 2 10
MIRT476318 GM2A GM2 ganglioside activator 2 2
MIRT476676 FUT11 fucosyltransferase 11 2 10
MIRT478368 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT479545 CDC5L cell division cycle 5 like 2 2
MIRT481024 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT491009 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT493168 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT494345 CASKIN1 CASK interacting protein 1 2 2
MIRT499087 ZDHHC21 zinc finger DHHC-type containing 21 2 6
MIRT500029 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501298 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 4
MIRT503124 BCL11B B-cell CLL/lymphoma 11B 2 8
MIRT503301 GTF2A1 general transcription factor IIA subunit 1 2 6
MIRT504328 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504471 EID2B EP300 interacting inhibitor of differentiation 2B 2 2
MIRT504655 RPL9 ribosomal protein L9 2 6
MIRT505331 TMF1 TATA element modulatory factor 1 2 8
MIRT505732 SERTAD3 SERTA domain containing 3 2 4
MIRT505827 RSBN1 round spermatid basic protein 1 2 8
MIRT506004 PURG purine rich element binding protein G 2 8
MIRT506308 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT506806 KLHL15 kelch like family member 15 2 6
MIRT507119 GOLGA8B golgin A8 family member B 2 6
MIRT507353 FAM129A family with sequence similarity 129 member A 2 6
MIRT507591 DDX3X DEAD-box helicase 3, X-linked 2 4
MIRT507674 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 4
MIRT507703 CNOT2 CCR4-NOT transcription complex subunit 2 2 8
MIRT508012 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT510439 ZIC5 Zic family member 5 2 6
MIRT510539 XKR7 XK related 7 2 4
MIRT510600 TPPP tubulin polymerization promoting protein 2 6
MIRT511060 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT511855 GOLGA8J golgin A8 family member J 2 6
MIRT511865 GOLGA8I golgin A8 family member I, pseudogene 1 3
MIRT512570 CTDSPL CTD small phosphatase like 2 2
MIRT512708 ZNF134 zinc finger protein 134 2 6
MIRT513177 MOAP1 modulator of apoptosis 1 2 6
MIRT513783 PAWR pro-apoptotic WT1 regulator 2 6
MIRT515099 IRGQ immunity related GTPase Q 2 2
MIRT515481 INCENP inner centromere protein 2 4
MIRT517416 BMP8A bone morphogenetic protein 8a 2 2
MIRT518754 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519780 ZNF354B zinc finger protein 354B 2 4
MIRT519865 ZFP62 ZFP62 zinc finger protein 2 6
MIRT520510 TRAM2 translocation associated membrane protein 2 2 6
MIRT521068 SLC25A32 solute carrier family 25 member 32 2 6
MIRT526912 ZNF772 zinc finger protein 772 2 6
MIRT527134 GULP1 GULP, engulfment adaptor PTB domain containing 1 2 2
MIRT527867 SLC39A14 solute carrier family 39 member 14 2 2
MIRT528404 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT532956 ZNF24 zinc finger protein 24 2 4
MIRT533021 ZFC3H1 zinc finger C3H1-type containing 2 4
MIRT533191 WASL Wiskott-Aldrich syndrome like 2 6
MIRT534191 SLC7A11 solute carrier family 7 member 11 2 2
MIRT534961 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 4
MIRT536396 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT537046 GRAMD4 GRAM domain containing 4 2 2
MIRT537125 GOLGA3 golgin A3 2 4
MIRT537183 GFPT2 glutamine-fructose-6-phosphate transaminase 2 2 4
MIRT537652 ERGIC2 ERGIC and golgi 2 2 4
MIRT538632 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539231 ANP32E acidic nuclear phosphoprotein 32 family member E 2 6
MIRT540099 NPY4R neuropeptide Y receptor Y4 2 2
MIRT540998 ZNF460 zinc finger protein 460 2 4
MIRT541468 AURKA aurora kinase A 2 2
MIRT542680 SESN3 sestrin 3 2 2
MIRT542757 PRRG4 proline rich and Gla domain 4 2 2
MIRT542863 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT542925 HOXC8 homeobox C8 2 2
MIRT543747 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT544404 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT544583 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544662 MED19 mediator complex subunit 19 2 2
MIRT545251 GTF2E1 general transcription factor IIE subunit 1 2 2
MIRT545261 TRIM36 tripartite motif containing 36 2 4
MIRT545744 UHRF1BP1 UHRF1 binding protein 1 2 2
MIRT545999 WDR81 WD repeat domain 81 2 2
MIRT546038 VPS4B vacuolar protein sorting 4 homolog B 2 2
MIRT547170 PDZD8 PDZ domain containing 8 2 2
MIRT547273 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT547729 KIF5B kinesin family member 5B 2 2
MIRT548127 GATA6 GATA binding protein 6 2 2
MIRT548203 FNIP1 folliculin interacting protein 1 2 2
MIRT548756 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT549641 ZNF75A zinc finger protein 75a 2 2
MIRT549684 ZNF598 zinc finger protein 598 2 2
MIRT550197 MRO maestro 2 2
MIRT550340 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT550536 MYZAP myocardial zonula adherens protein 2 2
MIRT550975 TOR4A torsin family 4 member A 2 2
MIRT551221 CIDEC cell death inducing DFFA like effector c 2 2
MIRT551355 AGBL5 ATP/GTP binding protein like 5 2 2
MIRT551571 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 2 2
MIRT552277 RAB3D RAB3D, member RAS oncogene family 2 2
MIRT552661 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT553081 UCK2 uridine-cytidine kinase 2 2 2
MIRT553753 TBC1D8 TBC1 domain family member 8 2 2
MIRT554030 SPCS3 signal peptidase complex subunit 3 2 2
MIRT554099 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT554155 SLX4 SLX4 structure-specific endonuclease subunit 2 2
MIRT554815 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT555522 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT555597 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 2 2
MIRT555632 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 4
MIRT555679 PGAM4 phosphoglycerate mutase family member 4 2 4
MIRT555827 PAX9 paired box 9 2 2
MIRT555868 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT555939 NUP43 nucleoporin 43 2 2
MIRT555994 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT556340 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556432 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT556585 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT556801 KIAA1958 KIAA1958 2 2
MIRT558047 EXOC5 exocyst complex component 5 2 2
MIRT558697 CLTA clathrin light chain A 2 2
MIRT559191 BMPR1A bone morphogenetic protein receptor type 1A 2 4
MIRT559639 AKAP10 A-kinase anchoring protein 10 2 2
MIRT559707 AEN apoptosis enhancing nuclease 2 2
MIRT560673 SRFBP1 serum response factor binding protein 1 2 2
MIRT560990 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT562170 HOXA13 homeobox A13 2 2
MIRT562275 GNAQ G protein subunit alpha q 2 2
MIRT563624 ZNF277 zinc finger protein 277 2 2
MIRT563815 FMN1 formin 1 2 2
MIRT564096 TLR3 toll like receptor 3 2 2
MIRT565320 TMEM41A transmembrane protein 41A 2 2
MIRT565986 RNF44 ring finger protein 44 2 2
MIRT566047 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT568236 C11orf24 chromosome 11 open reading frame 24 2 2
MIRT568310 BAK1 BCL2 antagonist/killer 1 2 2
MIRT572376 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT574822 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT609212 PELP1 proline, glutamate and leucine rich protein 1 2 2
MIRT616217 RBM27 RNA binding motif protein 27 2 2
MIRT629087 FASLG Fas ligand 2 2
MIRT632124 FKBP9 FK506 binding protein 9 2 2
MIRT632576 POLQ DNA polymerase theta 2 2
MIRT634799 ENTHD1 ENTH domain containing 1 2 2
MIRT636553 ESRP1 epithelial splicing regulatory protein 1 2 2
MIRT640977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT653875 SH2B3 SH2B adaptor protein 3 2 2
MIRT655598 OTUD7B OTU deubiquitinase 7B 2 2
MIRT659764 CCDC171 coiled-coil domain containing 171 2 2
MIRT660744 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT681037 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682305 RBM28 RNA binding motif protein 28 2 2
MIRT682573 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT686217 ZNF267 zinc finger protein 267 2 2
MIRT687209 PLXNA3 plexin A3 2 2
MIRT690630 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT692419 AGMAT agmatinase 2 2
MIRT694437 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT700725 PNO1 partner of NOB1 homolog 2 2
MIRT701549 NARF nuclear prelamin A recognition factor 2 2
MIRT704379 DAND5 DAN domain BMP antagonist family member 5 2 2
MIRT707935 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT709939 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT711371 MED7 mediator complex subunit 7 2 2
MIRT712327 PER2 period circadian clock 2 2 2
MIRT714515 SHE Src homology 2 domain containing E 2 2
MIRT715520 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT724294 OSMR oncostatin M receptor 2 2
MIRT725358 MUC21 mucin 21, cell surface associated 2 2
MIRT732242 KLF4 Kruppel like factor 4 3 1
MIRT735384 SPAG5 sperm associated antigen 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-367 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-367 Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 up-regulated
miR-367 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-367 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-367 Paclitaxel approved 36314 Microarray Ovarian cancer cell lines 24220856 2014 up-regulated
miR-367 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-367 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Siop Treatment Protocol sensitive High Nephroblastoma tissue
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-367-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (SKhep1, HA22T)
hsa-miR-367-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-367-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission