>ANKRD44|NM_153697|3'UTR
   1 GTTACCGCAAAAATACGGTGGAATAATTGCCTCAAGTGGGAATACTGCCAAAAAGATTCTTCCGTGCAGTAGATAGTTCC
  81 CATTTATCCAGGTTAAGGTGGATCTATACCATTATACTAAATACAAATTAAATTTTAAATAAATTAAGTGCCTTTTAATG
 161 ACAGAGGCAAAGAAGAACCAATTTTATTTTTTAGCTTCATCCAAATGAGGTCTATTTCAGTGGTTTTAATTAAGGAAACT
 241 TGAACTTTATTCGTAACTTTTCTTTCTAATATTCTTCTGTCCTTCCCAATGCTTCATATTAAACAGGAAAAATAAAACCT
 321 AACTGAGCCAATTTAGAATGT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cuaUAUAUGUCUAAGGUAUGUAGa 5' :|| |:|| | |||| :||| Target 5' gcaGTAGATAGTTCCCATTTATCc 3'	66 - 89	125.00	-9.50
2	miRNA 3' cuAUAUAUG----UCUAAGGUAUGUaga 5' | ||||| | | | ||||| Target 5' gaTCTATACCATTATACTAAATACAaat 3'	101 - 128	116.00	-5.10
3	miRNA 3' cuAUAUAUGUCUAAGG--UAUGUAGa 5' | |:| | |||| ||:| || Target 5' ctTCTGTCC---TTCCCAATGCTTCa 3'	274 - 296	105.00	-5.10

Mutant ID	Mutant Position	Mutant Source
COSM3962146	6	COSMIC
COSN166369	7	COSMIC
COSN31526660	17	COSMIC
COSN31512579	21	COSMIC
COSN30149321	48	COSMIC
COSN31543282	59	COSMIC
COSN31561310	59	COSMIC
COSN26564479	63	COSMIC
COSN6556266	64	COSMIC
COSN31601157	95	COSMIC
COSN16921279	253	COSMIC
COSN32013957	304	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs747411025	4	dbSNP
rs375696827	6	dbSNP
rs188278255	7	dbSNP
rs1278050714	13	dbSNP
rs781349237	14	dbSNP
rs142683674	16	dbSNP
rs1301331146	17	dbSNP
rs888343739	18	dbSNP
rs372823961	26	dbSNP
rs1170089408	30	dbSNP
rs1408539125	34	dbSNP
rs749260399	50	dbSNP
rs1437068472	55	dbSNP
rs182859493	63	dbSNP
rs929907103	64	dbSNP
rs564602154	66	dbSNP
rs1186616168	67	dbSNP
rs889011343	69	dbSNP
rs922247291	72	dbSNP
rs1472112143	75	dbSNP
rs544604023	89	dbSNP
rs1224272833	92	dbSNP
rs1165548481	96	dbSNP
rs139129065	99	dbSNP
rs1272846961	103	dbSNP
rs998108250	106	dbSNP
rs538802814	109	dbSNP
rs1410615012	118	dbSNP
rs1292782782	119	dbSNP
rs1346359145	128	dbSNP
rs745689187	129	dbSNP
rs1010093891	132	dbSNP
rs1338668617	146	dbSNP
rs1193865194	148	dbSNP
rs893955743	148	dbSNP
rs375770300	163	dbSNP
rs111326163	199	dbSNP
rs1254919892	204	dbSNP
rs778357025	207	dbSNP
rs938173379	210	dbSNP
rs1187624876	215	dbSNP
rs756918110	228	dbSNP
rs1369613614	231	dbSNP
rs1475341217	234	dbSNP
rs986298011	238	dbSNP
rs968651447	252	dbSNP
rs915426480	253	dbSNP
rs988370838	256	dbSNP
rs191940519	257	dbSNP
rs1480986091	260	dbSNP
rs1400322964	262	dbSNP
rs187468695	265	dbSNP
rs1397932816	270	dbSNP
rs956947924	278	dbSNP
rs1334844258	279	dbSNP
rs1325796742	289	dbSNP
rs1034987852	294	dbSNP
rs1201146104	304	dbSNP
rs1010628746	319	dbSNP
rs1299581456	324	dbSNP
rs1342657145	325	dbSNP
rs183502218	327	dbSNP

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.