>AHSA2|NM_152392|3'UTR
   1 ATTAAAATTTATTATAAGGCATTACTTTTTGTAAGCGGAAAAAGTGTCACATTTACCTCTTCCCTATCTTTTGTTTAAAA
  81 GGACTGTCTTTATTTTATATTGGATGAAATCTATGAACATATATACAATGTAAAGCATTGTTTGACTCTTTATTATAACT
 161 AGACACTGCATTGATTTAAAAGTAGCAAACAACCTGAAATTAAGTATTAACCTGACCTTCCATCGATATTCCTCTGGAAA
 241 TAGGTAAGTCCTGAGTGCAGATAGTTGATGTTTCCCAAGCTGAAGCTTGTCCTATAGCAAGCTTGCTTGCAGCTGTACTT
 321 TTAGTTCAAGATGACAAAAAATAAATGGCATGTTGACACTATTCCTTTATTTTACTTTAGGGTTTTTAAGGTGTGTAGAT
 401 CTTAGGTCGTAAAACAGTGGTATATTGCATTCAAAAGCATGTTGAGGTGAGGGCAAATTGGCTGTGTTTTGCTCCACATC
 481 TCCCTGCACATCTCCCTGCTGTGGTTTTGCACTTCGGTGTGGAGAGGATTGAGAAGTCTGTGGGGACACATTAGTTCTGT
 561 GGACTGCTGGTAACACTTCCAGTGAAACAGCATATAATGGATAAATGTTTCCCCCCTCTTTCACGGTTTTCTCACTACTT
 641 TCACCTGAGAAGACTGAAGCAACGTATGTAAACAAATGAAAAGTCATCACAATCAGTTTAATTAAGTGCACAGAATAGCA
 721 ATCAATCAATCAGTCATGTCAATAAAAATAAAACAATTATTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gauACCCACCCUGUCUCUCCc 5' | |||| ::|||||| Target 5' actTCGGTG---TGGAGAGGa 3'	511 - 528	135.00	-14.00
2	miRNA 3' gauACCCACCCUGUCUCUCcc 5' || ||| |||| || Target 5' tccTGAGTG---CAGATAGtt 3'	249 - 266	103.00	-5.76
3	miRNA 3' gaUACCCACCCUGUCUCUCCc 5' | | || : :| |||| Target 5' aaAAGCATGTTGAGGTGAGGg 3'	433 - 453	95.00	-10.00

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.