pre-miRNA Information
pre-miRNA hsa-mir-2115   
Genomic Coordinates chr3: 48316360 - 48316459
Description Homo sapiens miR-2115 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2115-3p
Sequence 58| CAUCAGAAUUCAUGGAGGCUAG |79
Evidence Experimental
Experiments 454
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31490809 22 COSMIC
COSN31579735 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs543123304 18 dbSNP
rs1450988157 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ADSS   
Synonyms ADEH, ADSS 2
Description adenylosuccinate synthase
Transcript NM_001126   
Expression
Putative miRNA Targets on ADSS
3'UTR of ADSS
(miRNA target sites are highlighted)
>ADSS|NM_001126|3'UTR
   1 TGATTGCCAGTAATGCAAGAAACACTCCTTGAGAGGGAGGGGAAAAGACTTTCTTAAATATTTCATTTATGACCTGCAAA
  81 TTCAAGAATAAAGACACTGAAGTAAGTTTGAAGCCCTACAGTTGTTTCCAGTCTTTTCAGATGGATGCCTACTGTGGAGA
 161 TTAACTTTGGCATATTCCAGTGTCAGCTTTCTTTAGCTGGAATTGCCAAATCATTTGTTGCTCCTGCTGCTCTCATGGTG
 241 CCACGTTTTTTTTTTCAATGTTTAGTAATAGTATAATCCATGTTGTTTGATATCAAAAGTAGAATTACTTTTAATGTAGT
 321 TTTTCTTCATTATTGTCATTGCGTGTTCTTAAGTTTTACCCCTATTAGATGGTAAGAACAATTAATGCAGTTTTGCACAA
 401 ATATTTTTACATTCTGATCATTCAGTTCTGTCATTGTAATCTTTGTTGTTAGAAACAAATGATGAAAACATAGGGGTTCT
 481 GTAAACTTTTGTAATGCTATGAATTCTGTTTAAATTTTGGGCTGTCTATTTTCTGCTGAAACCATGCAAAATTGAGCTTT
 561 GGTGGGGCTGGGAGGGGGTTATGTATTCATGGGACCTTTAATTTGTACAGAACACAGAACTTATTTCTGTCAGTTATTTA
 641 ATACATTGAAAATTTAGTGAAATGTTCAAAGAGAATAGATGTTTCCCAAAACAACAATCTTTATGTTAAAAATAGTCATT
 721 AAAAGATCTGTTGTAATATATGGTGGATATTTTTCTTTAATTTCAAACATTACCTCTGAAATGTGTATCTTTTCTTTTTT
 801 ATCTTACCATTAATTTTAAATCTAGTGGATTGGTTTTCAACATCGTGCCTGCCGATATGCCTACAGAATCATCTGTAAGT
 881 GTCAAAATGAACCCACGTTGTTAGCCATAATTTTGATTATGCCTTTATTTCTCCTTTCTTGAAAAAAAAAAGGTGTTATT
 961 TTGACAATTAGGCATAACATTGTTTTGTAGATTATCTTTTAATGAACTATTTTAAATGTTAAATTAGGTGCCACTTAAAT
1041 TTATTTTATTACACCATGAATAGCTGATTAAAAGAACCAAATATTTCTAGTATGAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gaucggAGGUACUUAAGACUAc 5'
                |:: |  |||||||| 
Target 5' caaataTTTTTACATTCTGATc 3'
398 - 419 148.00 -6.80
2
miRNA  3' gaucggaGGUACUUAAGACUAc 5'
                 |||| ||||:|||| 
Target 5' ttgttagCCAT-AATTTTGATt 3'
898 - 918 146.00 -10.40
3
miRNA  3' gaucggaGGUACUUAAGACUAc 5'
                 |:|||||||||| | 
Target 5' tgtaatgCTATGAATTCTGTTt 3'
490 - 511 139.00 -15.42
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30186031 2 COSMIC
COSN30451475 28 COSMIC
COSN13531264 35 COSMIC
COSN30147579 37 COSMIC
COSN31585735 47 COSMIC
COSN30452228 64 COSMIC
COSN30504775 66 COSMIC
COSN26565673 97 COSMIC
COSN30514927 97 COSMIC
COSN30502043 104 COSMIC
COSN30511050 129 COSMIC
COSN20096208 245 COSMIC
COSN15662456 307 COSMIC
COSN8453261 473 COSMIC
COSN26665123 616 COSMIC
COSN21461186 625 COSMIC
COSN30169504 706 COSMIC
COSN30543715 743 COSMIC
COSN31564826 755 COSMIC
COSN1440495 763 COSMIC
COSN20729400 832 COSMIC
COSN20096207 941 COSMIC
COSN29329295 1011 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775010741 9 dbSNP
rs763477587 10 dbSNP
rs1482569529 12 dbSNP
rs773613590 17 dbSNP
rs769381301 22 dbSNP
rs1361862529 24 dbSNP
rs142770938 25 dbSNP
rs768237912 27 dbSNP
rs746467727 28 dbSNP
rs1323018600 34 dbSNP
rs901724210 35 dbSNP
rs1310738906 37 dbSNP
rs1223307603 38 dbSNP
rs1314012935 39 dbSNP
rs779975384 41 dbSNP
rs1348954085 42 dbSNP
rs758332023 43 dbSNP
rs750263853 46 dbSNP
rs756959937 48 dbSNP
rs752982808 49 dbSNP
rs536580352 51 dbSNP
rs1241668453 53 dbSNP
rs1488760194 56 dbSNP
rs1192793707 58 dbSNP
rs999478620 70 dbSNP
rs1479965477 76 dbSNP
rs1159661576 82 dbSNP
rs372936425 84 dbSNP
rs1413670921 85 dbSNP
rs1335879577 88 dbSNP
rs1322306332 90 dbSNP
rs1157754299 102 dbSNP
rs369919965 114 dbSNP
rs1437989647 145 dbSNP
rs1295758570 149 dbSNP
rs1366138500 151 dbSNP
rs1404693543 152 dbSNP
rs1045518459 154 dbSNP
rs1043474934 160 dbSNP
rs111320617 161 dbSNP
rs1304136442 166 dbSNP
rs1331481989 167 dbSNP
rs148535556 168 dbSNP
rs1283845073 175 dbSNP
rs915988741 180 dbSNP
rs1160564978 185 dbSNP
rs1470616522 186 dbSNP
rs1223909757 190 dbSNP
rs547499743 205 dbSNP
rs1196825982 214 dbSNP
rs1449804994 221 dbSNP
rs767953645 229 dbSNP
rs1222989578 232 dbSNP
rs755371449 236 dbSNP
rs1414102346 241 dbSNP
rs1283589466 243 dbSNP
rs752116051 244 dbSNP
rs556782598 245 dbSNP
rs1424663147 255 dbSNP
rs201400497 256 dbSNP
rs398103917 256 dbSNP
rs76040005 256 dbSNP
rs1408392790 257 dbSNP
rs1350931488 258 dbSNP
rs1279149333 271 dbSNP
rs972275098 273 dbSNP
rs113711112 275 dbSNP
rs536837642 279 dbSNP
rs1310752165 281 dbSNP
rs1284432919 285 dbSNP
rs962291660 291 dbSNP
rs1358626234 293 dbSNP
rs3087609 307 dbSNP
rs551409330 316 dbSNP
rs778369211 320 dbSNP
rs953125432 320 dbSNP
rs1203582733 331 dbSNP
rs1029164983 332 dbSNP
rs1473595764 333 dbSNP
rs1179607418 337 dbSNP
rs944413169 338 dbSNP
rs1449561621 341 dbSNP
rs767687620 342 dbSNP
rs192048704 343 dbSNP
rs1408525565 345 dbSNP
rs544085026 362 dbSNP
rs965861681 362 dbSNP
rs1401693992 364 dbSNP
rs1359932122 372 dbSNP
rs1450531971 374 dbSNP
rs986287338 386 dbSNP
rs1030869108 397 dbSNP
rs1170896134 401 dbSNP
rs1481434886 404 dbSNP
rs999426115 420 dbSNP
rs1340025044 426 dbSNP
rs903790016 461 dbSNP
rs953552360 461 dbSNP
rs565636331 462 dbSNP
rs548686962 469 dbSNP
rs1477454207 489 dbSNP
rs1043027809 490 dbSNP
rs915495189 492 dbSNP
rs1242154110 493 dbSNP
rs1464924895 495 dbSNP
rs1011993362 503 dbSNP
rs763195509 517 dbSNP
rs188643354 522 dbSNP
rs1426242584 528 dbSNP
rs761772668 528 dbSNP
rs938796038 532 dbSNP
rs183595622 536 dbSNP
rs1003565295 544 dbSNP
rs928787374 547 dbSNP
rs1435872672 551 dbSNP
rs1036505335 552 dbSNP
rs1324609792 557 dbSNP
rs1198256226 567 dbSNP
rs940915185 575 dbSNP
rs909465281 576 dbSNP
rs984436332 578 dbSNP
rs953161502 579 dbSNP
rs1263185671 582 dbSNP
rs921653783 582 dbSNP
rs975817351 586 dbSNP
rs1048957791 589 dbSNP
rs1218633713 606 dbSNP
rs965809809 607 dbSNP
rs1193015956 618 dbSNP
rs774705210 624 dbSNP
rs1272301155 630 dbSNP
rs1030816931 655 dbSNP
rs1479181115 656 dbSNP
rs999373806 663 dbSNP
rs550440493 664 dbSNP
rs1431847455 669 dbSNP
rs533528247 674 dbSNP
rs1332377751 675 dbSNP
rs765607331 680 dbSNP
rs1161449783 703 dbSNP
rs1382813404 705 dbSNP
rs1381729544 706 dbSNP
rs1324085239 716 dbSNP
rs1471063523 717 dbSNP
rs1406971068 721 dbSNP
rs1022631568 730 dbSNP
rs1402850641 731 dbSNP
rs1012198922 736 dbSNP
rs35885954 738 dbSNP
rs1170047850 750 dbSNP
rs1282441989 777 dbSNP
rs1465055057 787 dbSNP
rs762121079 791 dbSNP
rs1350726253 801 dbSNP
rs1229787480 817 dbSNP
rs1258587983 826 dbSNP
rs995126994 832 dbSNP
rs1209935164 838 dbSNP
rs564441604 842 dbSNP
rs1034335492 844 dbSNP
rs768749251 853 dbSNP
rs1268691840 854 dbSNP
rs1473133353 858 dbSNP
rs1184537640 861 dbSNP
rs1362314872 865 dbSNP
rs944419442 874 dbSNP
rs907307653 875 dbSNP
rs762855148 879 dbSNP
rs1050212103 881 dbSNP
rs1036452995 885 dbSNP
rs940867561 886 dbSNP
rs775108524 896 dbSNP
rs541478611 897 dbSNP
rs1411462614 900 dbSNP
rs1304350658 904 dbSNP
rs775360653 907 dbSNP
rs1334853471 909 dbSNP
rs932281312 914 dbSNP
rs1306272335 915 dbSNP
rs921577846 916 dbSNP
rs1220835241 920 dbSNP
rs1291702539 936 dbSNP
rs759334673 937 dbSNP
rs1215543743 941 dbSNP
rs944410800 949 dbSNP
rs1418763196 952 dbSNP
rs375505040 952 dbSNP
rs397962172 952 dbSNP
rs546910013 952 dbSNP
rs61084783 952 dbSNP
rs1491361146 953 dbSNP
rs527766409 971 dbSNP
rs1390734887 972 dbSNP
rs1296276168 994 dbSNP
rs1431376702 994 dbSNP
rs1395310674 1003 dbSNP
rs774331138 1004 dbSNP
rs977875288 1007 dbSNP
rs1383731558 1008 dbSNP
rs1379860257 1009 dbSNP
rs769885759 1015 dbSNP
rs1244646235 1016 dbSNP
rs562139270 1049 dbSNP
rs1023671917 1054 dbSNP
rs1022157577 1065 dbSNP
rs115523508 1074 dbSNP
rs952805163 1074 dbSNP
rs369680128 1085 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 159.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 159.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000366535.3 | 3UTR | AACAAUUAAUGCAGUUUUGCACAAAUAUUUUUACAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000366535.3 | 3UTR | UUUUACCCCUAUUAGAUGGUAAGAACAAUUAAUGCAGUUUUGCACAAAUAUUUUUACAUUCUGAUCAUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000366535.3 | 3UTR | AUGCAGUUUUGCACAAAUAUUUUUACAUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.925 0.12 0.500 0.33 3 Click to see details
LUSC -0.219 0.22 -0.104 0.36 15 Click to see details
UCEC -0.736 0.24 -0.500 0.33 3 Click to see details
HNSC -0.197 0.25 -0.068 0.41 14 Click to see details
LIHC 0.369 0.32 0.200 0.4 4 Click to see details
BRCA -0.073 0.35 -0.027 0.44 31 Click to see details
BLCA -0.098 0.43 -0.143 0.39 6 Click to see details
BLCA -0.098 0.43 -0.143 0.39 6 Click to see details
BLCA -0.098 0.43 -0.143 0.39 6 Click to see details
BLCA -0.098 0.43 -0.143 0.39 6 Click to see details
BLCA -0.098 0.43 -0.143 0.39 6 Click to see details
BLCA -0.098 0.43 -0.143 0.39 6 Click to see details
BLCA -0.098 0.43 -0.143 0.39 6 Click to see details
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057089 DDIT4 DNA damage inducible transcript 4 2 2
MIRT071216 FCF1 FCF1, rRNA-processing protein 2 2
MIRT226901 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235961 BACH1 BTB domain and CNC homolog 1 2 2
MIRT294569 ZNF460 zinc finger protein 460 2 4
MIRT321046 RAC1 Rac family small GTPase 1 2 4
MIRT359666 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 8
MIRT366451 KLHL15 kelch like family member 15 2 2
MIRT405375 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT441794 TCEAL5 transcription elongation factor A like 5 2 2
MIRT443295 TCEAL3 transcription elongation factor A like 3 2 2
MIRT455275 DDX39B DExD-box helicase 39B 2 2
MIRT458523 C5orf22 chromosome 5 open reading frame 22 2 2
MIRT464960 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT466848 STX6 syntaxin 6 2 2
MIRT469252 RHOB ras homolog family member B 2 2
MIRT469825 RAB14 RAB14, member RAS oncogene family 2 4
MIRT470047 PTGFRN prostaglandin F2 receptor inhibitor 2 2
MIRT471420 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT472024 NPM1 nucleophosmin 1 2 2
MIRT484156 CENPN centromere protein N 2 2
MIRT485490 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT490462 PROSER2 proline and serine rich 2 2 2
MIRT493069 MTCH1 mitochondrial carrier 1 2 2
MIRT493573 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT494919 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT500439 ZMAT3 zinc finger matrin-type 3 2 2
MIRT500931 SRPR SRP receptor alpha subunit 2 4
MIRT501551 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT501809 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT502415 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT506504 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT507861 CCNE2 cyclin E2 2 2
MIRT510511 YOD1 YOD1 deubiquitinase 2 6
MIRT516073 RAB42 RAB42, member RAS oncogene family 2 2
MIRT519030 KYNU kynureninase 2 6
MIRT521762 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522898 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527370 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530691 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT530867 TRUB1 TruB pseudouridine synthase family member 1 2 2
MIRT531832 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT533035 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT533165 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT533464 TRIM71 tripartite motif containing 71 2 2
MIRT534331 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT539372 ADSS adenylosuccinate synthase 2 6
MIRT545951 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553283 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553532 TMEM185B transmembrane protein 185B 2 4
MIRT556480 LIPA lipase A, lysosomal acid type 2 2
MIRT556975 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT557697 GATA6 GATA binding protein 6 2 2
MIRT558901 CCDC58 coiled-coil domain containing 58 2 2
MIRT559224 BLMH bleomycin hydrolase 2 2
MIRT559827 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT563435 SLC3A2 solute carrier family 3 member 2 2 2
MIRT569270 PCDH11X protocadherin 11 X-linked 2 2
MIRT571386 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572567 AFF1 AF4/FMR2 family member 1 2 2
MIRT610400 AR androgen receptor 2 2
MIRT611058 ZNF621 zinc finger protein 621 2 2
MIRT635118 TMEM233 transmembrane protein 233 2 2
MIRT641617 DEFB118 defensin beta 118 2 2
MIRT642146 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT647295 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT648155 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT652780 TENM3 teneurin transmembrane protein 3 2 2
MIRT657356 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT658718 ELN elastin 2 2
MIRT662441 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT665302 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT699898 RUNX1 runt related transcription factor 1 2 2
MIRT700921 PDS5A PDS5 cohesin associated factor A 2 2
MIRT700992 PDE3A phosphodiesterase 3A 2 2
MIRT707397 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT711895 INSIG2 insulin induced gene 2 2 2
MIRT712072 XRCC5 X-ray repair cross complementing 5 2 2
MIRT716121 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT724470 SMAD2 SMAD family member 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2115 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-2115 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-2115-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-2115-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-2115-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission