pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6511b-1 |
Genomic Coordinates | chr16: 2106669 - 2106753 |
Description | Homo sapiens miR-6511b-1 stem-loop |
Comment | None |
RNA Secondary Structure | |
pre-miRNA | hsa-mir-6511b-2 |
Genomic Coordinates | chr16: 15134075 - 15134145 |
Description | Homo sapiens miR-6511b-2 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6511b-3p | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence | 53| CCUCACCACCCCUUCUGCCUGCA |75 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ACTN4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | ACTININ-4, FSGS, FSGS1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | actinin alpha 4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_004924 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on ACTN4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of ACTN4 (miRNA target sites are highlighted) |
>ACTN4|NM_004924|3'UTR 1 GGCCCCAGAGACCTGACCCAACACCCCCGACGGCCTCCAGGAGGGGCCTGGGCAGCCCCACAGTCCCATTCCTCCACTCT 81 GTATCTATGCAAAGCACTCTCTGCAGTCCTCCGGGGTGGGTGGGTGGGCAGGGAGGGGCTGGGGCAGGCTCTCTCCTCTC 161 TCTCTTTGTGGGTTGGCCAGGAGGTTCCCCCGACCAGGTTGGGGAGACTTGGGGCCAGCGCTTCTGGTCTGGTAAATATG 241 TATGATGTGTTGTGCTTTTTTAACCAAGGAGGGGCCAGTGGATTCCCACAGCACAACCGGTCCCTTCCATGCCCTGGGAT 321 GCCTCACCACACCCAGGTCTCTTCCTTTGCTCTGAGGTCCCTTCAAGGCCTCCCCAATCCAGGCCAAAGCCCCATGTGCC 401 TTGTCCAGGAACTGCCTGGGCCATGCGAGGGGCCAGCAGAGGGCGCCACCACCACCTGACGGCTGGGGACCCACCCAGCC 481 CCTCTCCCCTCTCTGCTCCAGACTCACTTGCCATTGCCAGGAGATGGCCCCAACAAGCACCCCGCTTTTGCAGCAGAGGA 561 GCTGAGTTGGCAGACCGGGCCCCCCTGAACCGCACCCCATCCCACCAGCCCCGGCCTTGCTTTGTCTGGCCTCACGTGTC 641 TCAGATTTTCTAAGAACCAAAAAAAAAAAAGGAAAAAAAACACAAAACAACAAAAACCAAAAAAAAAAAAAATCACAAAA 721 ACAAAAAAACTATAAAAAAGAAAGAATTAAAAACTTTCAGAGAATTACTATTTACTTTATTAACTTACGGATTTATTATA 801 TAAATATATATTCACCTAGCAACATATCTCTGCCGTCTCTCCTGCTCTCATAATGAAGACATAGCCGATTCTCTGCCCGG 881 GCCCCTTGCTGATGCTCCTCCGGGTCTGCGTCGGGCGTGGGTCTCTGGGGACCCTCCAGAGGTGGAGGTGGGCTGATGGC 961 CTGGCTGCCTGGTGGTTGATGGTTTTGCTCCCCCTACCTTTTTTTTTTGAGTTTATTCTGATTGATTTTTTTTCTTGGTT 1041 TCTGGATAAACCACCCTCTGGGGACAGGATAATAAAACATGTAATATTTTTAAGAAGGATAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
miRNA:Target | ---- | |||||||||
Validation Method |
|
|||||||||
Conditions | hESCs (WA-09) | |||||||||
Disease | 81.0 | |||||||||
Location of target site | 3'UTR | |||||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | |||||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
|||||||||
miRNA-target interactions (Provided by authors) |
|
|||||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000252699.2 | 3UTR | ggugagggucugggucagcugguuguucagguggaagcC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
69 hsa-miR-6511b-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT059269 | CELF1 | CUGBP Elav-like family member 1 | 2 | 2 | ||||||||
MIRT061287 | IPO7 | importin 7 | 2 | 2 | ||||||||
MIRT115533 | MAZ | MYC associated zinc finger protein | 2 | 2 | ||||||||
MIRT345986 | BIRC5 | baculoviral IAP repeat containing 5 | 2 | 8 | ||||||||
MIRT379536 | HNRNPK | heterogeneous nuclear ribonucleoprotein K | 2 | 2 | ||||||||
MIRT442491 | RBBP5 | RB binding protein 5, histone lysine methyltransferase complex subunit | 2 | 8 | ||||||||
MIRT443701 | HUNK | hormonally up-regulated Neu-associated kinase | 2 | 4 | ||||||||
MIRT459167 | HSPA6 | heat shock protein family A (Hsp70) member 6 | 2 | 21 | ||||||||
MIRT497179 | ZBTB40 | zinc finger and BTB domain containing 40 | 2 | 2 | ||||||||
MIRT497846 | GATA6 | GATA binding protein 6 | 2 | 4 | ||||||||
MIRT519625 | ZNF781 | zinc finger protein 781 | 2 | 2 | ||||||||
MIRT519838 | ZFP69B | ZFP69 zinc finger protein B | 2 | 4 | ||||||||
MIRT528560 | DNAAF3 | dynein axonemal assembly factor 3 | 2 | 2 | ||||||||
MIRT530718 | ORMDL3 | ORMDL sphingolipid biosynthesis regulator 3 | 2 | 2 | ||||||||
MIRT530810 | GPR182 | G protein-coupled receptor 182 | 2 | 2 | ||||||||
MIRT533265 | VAV3 | vav guanine nucleotide exchange factor 3 | 2 | 4 | ||||||||
MIRT533726 | TMEM246 | transmembrane protein 246 | 2 | 2 | ||||||||
MIRT535547 | P2RY2 | purinergic receptor P2Y2 | 2 | 2 | ||||||||
MIRT536019 | MCUR1 | mitochondrial calcium uniporter regulator 1 | 2 | 2 | ||||||||
MIRT539494 | ACTN4 | actinin alpha 4 | 2 | 2 | ||||||||
MIRT541793 | MGAT5 | mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase | 2 | 8 | ||||||||
MIRT554509 | RUNX1T1 | RUNX1 translocation partner 1 | 2 | 2 | ||||||||
MIRT558784 | CEP55 | centrosomal protein 55 | 2 | 2 | ||||||||
MIRT560013 | ZNF525 | zinc finger protein 525 | 2 | 2 | ||||||||
MIRT560078 | ZNF195 | zinc finger protein 195 | 2 | 2 | ||||||||
MIRT570135 | IL1RL2 | interleukin 1 receptor like 2 | 2 | 2 | ||||||||
MIRT570890 | ZNF780A | zinc finger protein 780A | 2 | 2 | ||||||||
MIRT607972 | SNX22 | sorting nexin 22 | 2 | 2 | ||||||||
MIRT608104 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | 2 | 2 | ||||||||
MIRT610471 | ADAMTS13 | ADAM metallopeptidase with thrombospondin type 1 motif 13 | 2 | 4 | ||||||||
MIRT611134 | GGT7 | gamma-glutamyltransferase 7 | 2 | 2 | ||||||||
MIRT611448 | NRIP3 | nuclear receptor interacting protein 3 | 2 | 2 | ||||||||
MIRT613019 | GABPB1 | GA binding protein transcription factor beta subunit 1 | 2 | 4 | ||||||||
MIRT615753 | C6 | complement C6 | 2 | 2 | ||||||||
MIRT620464 | CERS6 | ceramide synthase 6 | 2 | 2 | ||||||||
MIRT632248 | VPS41 | VPS41, HOPS complex subunit | 2 | 2 | ||||||||
MIRT636099 | ZDHHC22 | zinc finger DHHC-type containing 22 | 2 | 2 | ||||||||
MIRT637452 | ZNF324B | zinc finger protein 324B | 2 | 2 | ||||||||
MIRT638927 | CALCOCO2 | calcium binding and coiled-coil domain 2 | 2 | 2 | ||||||||
MIRT646768 | WDR3 | WD repeat domain 3 | 2 | 2 | ||||||||
MIRT652610 | TIMM8A | translocase of inner mitochondrial membrane 8A | 2 | 2 | ||||||||
MIRT652868 | TAB1 | TGF-beta activated kinase 1 (MAP3K7) binding protein 1 | 2 | 2 | ||||||||
MIRT653655 | SLC27A4 | solute carrier family 27 member 4 | 2 | 2 | ||||||||
MIRT657089 | JMY | junction mediating and regulatory protein, p53 cofactor | 2 | 2 | ||||||||
MIRT657884 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | 2 | 2 | ||||||||
MIRT662919 | MED18 | mediator complex subunit 18 | 2 | 2 | ||||||||
MIRT685622 | C12orf49 | chromosome 12 open reading frame 49 | 2 | 2 | ||||||||
MIRT687427 | NRIP1 | nuclear receptor interacting protein 1 | 2 | 2 | ||||||||
MIRT692304 | CNNM3 | cyclin and CBS domain divalent metal cation transport mediator 3 | 2 | 2 | ||||||||
MIRT695127 | PRY2 | PTPN13-like, Y-linked 2 | 2 | 2 | ||||||||
MIRT695144 | PRY | PTPN13-like, Y-linked | 2 | 2 | ||||||||
MIRT696286 | IER3IP1 | immediate early response 3 interacting protein 1 | 2 | 2 | ||||||||
MIRT699350 | SLC35E1 | solute carrier family 35 member E1 | 2 | 2 | ||||||||
MIRT709901 | AGO1 | argonaute 1, RISC catalytic component | 2 | 2 | ||||||||
MIRT710877 | SLC25A42 | solute carrier family 25 member 42 | 2 | 2 | ||||||||
MIRT711365 | MED7 | mediator complex subunit 7 | 2 | 2 | ||||||||
MIRT711444 | FRMPD3 | FERM and PDZ domain containing 3 | 2 | 2 | ||||||||
MIRT713221 | RCAN2 | regulator of calcineurin 2 | 2 | 2 | ||||||||
MIRT713281 | LAIR1 | leukocyte associated immunoglobulin like receptor 1 | 2 | 2 | ||||||||
MIRT714195 | TRAF7 | TNF receptor associated factor 7 | 2 | 2 | ||||||||
MIRT715152 | IL12B | interleukin 12B | 2 | 2 | ||||||||
MIRT719197 | CASP10 | caspase 10 | 2 | 2 | ||||||||
MIRT719469 | SRF | serum response factor | 2 | 2 | ||||||||
MIRT720197 | MPP6 | membrane palmitoylated protein 6 | 2 | 2 | ||||||||
MIRT720449 | SLC16A5 | solute carrier family 16 member 5 | 2 | 2 | ||||||||
MIRT720461 | RAB31 | RAB31, member RAS oncogene family | 2 | 2 | ||||||||
MIRT721646 | ZNF207 | zinc finger protein 207 | 2 | 2 | ||||||||
MIRT722001 | CLLU1OS | chronic lymphocytic leukemia up-regulated 1 opposite strand | 2 | 2 | ||||||||
MIRT725521 | FAM229B | family with sequence similarity 229 member B | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|