pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-497 |
Genomic Coordinates | chr17: 7017911 - 7018022 |
Synonyms | MIRN497, hsa-mir-497, MIR497 |
Description | Homo sapiens miR-497 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-497-3p | ||||||||||||||||||||||||||||
Sequence | 64| CAAACCACACUGUGGUGUUAGA |85 | ||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||
Experiments | Cloned | ||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | BUB1 | ||||||||||||||||||||
Synonyms | BUB1A, BUB1L, hBUB1 | ||||||||||||||||||||
Description | BUB1 mitotic checkpoint serine/threonine kinase | ||||||||||||||||||||
Transcript | NM_004336 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on BUB1 | |||||||||||||||||||||
3'UTR of BUB1 (miRNA target sites are highlighted) |
>BUB1|NM_004336|3'UTR 1 AATTTGGATATAGACAGTCCTTAAAAATCACACTGTAAATATGAATCTGCTCACTTTAAACCTGTTTTTTTTTCATTTAT 81 TGTTTATGTAAATGTTTGTTAAAAATAAATCCCATGGAATATTTCCATGTAACTTAGTTGTTATAAATATTTCAACAAAA 161 TATACAACCCCATAAGGTCCCTATATAGCAGGCTGATTGGGCTGCTTCTGGGATGCAAGCATTTGTGAGAATAATTCAGA 241 CATGAGCATTCTCTAGAAATCACTTT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 699.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714647 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / mildMNase, repB |
Location of target site | ENST00000535254.1 | 3UTR | UUGAUUUGCAUUUCUCUGAUGGCCAGUGAUGAUGAGCAUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
95 hsa-miR-497-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT092955 | CYP2U1 | cytochrome P450 family 2 subfamily U member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT124568 | PRRC2B | proline rich coiled-coil 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT125196 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | ![]() |
![]() |
2 | 4 | ||||||
MIRT147296 | KPNA2 | karyopherin subunit alpha 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT163999 | KIAA1109 | KIAA1109 | ![]() |
![]() |
2 | 4 | ||||||
MIRT252495 | NWD1 | NACHT and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT357969 | GRPEL2 | GrpE like 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT443007 | TRIOBP | TRIO and F-actin binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT443524 | NETO1 | neuropilin and tolloid like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443573 | EVX2 | even-skipped homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443656 | BACH1 | BTB domain and CNC homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460670 | KRT10 | keratin 10 | ![]() |
![]() |
2 | 8 | ||||||
MIRT464761 | UBE2N | ubiquitin conjugating enzyme E2 N | ![]() |
![]() |
2 | 2 | ||||||
MIRT465032 | LINC00598 | long intergenic non-protein coding RNA 598 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465040 | TTC39C | tetratricopeptide repeat domain 39C | ![]() |
![]() |
2 | 2 | ||||||
MIRT468667 | SEC62 | SEC62 homolog, preprotein translocation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT473694 | MAPK8 | mitogen-activated protein kinase 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT477618 | EFNA3 | ephrin A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480506 | C11orf57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480592 | BUB3 | BUB3, mitotic checkpoint protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT486915 | ZNF398 | zinc finger protein 398 | ![]() |
![]() |
2 | 6 | ||||||
MIRT487770 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | ![]() |
![]() |
2 | 16 | ||||||
MIRT493265 | MDFIC | MyoD family inhibitor domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT495271 | SLC1A2 | solute carrier family 1 member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT495309 | CHST12 | carbohydrate sulfotransferase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496681 | DPP6 | dipeptidyl peptidase like 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT496891 | FOXP1 | forkhead box P1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497330 | IRF4 | interferon regulatory factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498272 | KIAA1644 | KIAA1644 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498634 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
![]() |
2 | 10 | ||||||
MIRT500581 | USP53 | ubiquitin specific peptidase 53 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500751 | TMPPE | transmembrane protein with metallophosphoesterase domain | ![]() |
![]() |
2 | 6 | ||||||
MIRT509668 | ZNF354B | zinc finger protein 354B | ![]() |
![]() |
2 | 10 | ||||||
MIRT510919 | PSMA2 | proteasome subunit alpha 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT519118 | CEP76 | centrosomal protein 76 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526193 | ABCG2 | ATP binding cassette subfamily G member 2 (Junior blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT526746 | HLA-DOB | major histocompatibility complex, class II, DO beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT527270 | FBLN2 | fibulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528198 | PLEKHM2 | pleckstrin homology and RUN domain containing M2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528330 | TBC1D22B | TBC1 domain family member 22B | ![]() |
![]() |
2 | 2 | ||||||
MIRT530346 | GABRB3 | gamma-aminobutyric acid type A receptor beta3 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT533627 | TMX3 | thioredoxin related transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533738 | TMEM200C | transmembrane protein 200C | ![]() |
![]() |
2 | 2 | ||||||
MIRT533779 | TMEM133 | transmembrane protein 133 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534317 | SKIDA1 | SKI/DACH domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538438 | COG5 | component of oligomeric golgi complex 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539156 | AREL1 | apoptosis resistant E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539474 | ADARB2 | adenosine deaminase, RNA specific B2 (inactive) | ![]() |
![]() |
2 | 2 | ||||||
MIRT539620 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539650 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT540346 | OPHN1 | oligophrenin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540412 | PITPNC1 | phosphatidylinositol transfer protein, cytoplasmic 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541200 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541395 | CDC27 | cell division cycle 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546443 | SNX5 | sorting nexin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547369 | MSI2 | musashi RNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553288 | TSPAN3 | tetraspanin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554402 | SERP1 | stress associated endoplasmic reticulum protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557822 | FOXN2 | forkhead box N2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568530 | ANP32E | acidic nuclear phosphoprotein 32 family member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT569508 | THYN1 | thymocyte nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570707 | FAM69A | family with sequence similarity 69 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT608376 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608483 | NKTR | natural killer cell triggering receptor | ![]() |
![]() |
2 | 6 | ||||||
MIRT613533 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT616601 | ELP2 | elongator acetyltransferase complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618166 | DUSP18 | dual specificity phosphatase 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632059 | CEP135 | centrosomal protein 135 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647379 | ZDHHC23 | zinc finger DHHC-type containing 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648366 | POTED | POTE ankyrin domain family member D | ![]() |
![]() |
2 | 2 | ||||||
MIRT651075 | ZNF518B | zinc finger protein 518B | ![]() |
![]() |
2 | 4 | ||||||
MIRT653618 | SLC30A4 | solute carrier family 30 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653636 | SLC30A1 | solute carrier family 30 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654895 | POU2F1 | POU class 2 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656232 | MFSD6 | major facilitator superfamily domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659880 | CAPRIN1 | cell cycle associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660526 | ARL4C | ADP ribosylation factor like GTPase 4C | ![]() |
![]() |
2 | 2 | ||||||
MIRT666286 | SLC30A3 | solute carrier family 30 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686808 | SNX2 | sorting nexin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT695302 | TK1 | thymidine kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699737 | SERINC3 | serine incorporator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700794 | PIAS2 | protein inhibitor of activated STAT 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712270 | PPP1CB | protein phosphatase 1 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT712617 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT714264 | RPL10A | ribosomal protein L10a | ![]() |
![]() |
2 | 2 | ||||||
MIRT715072 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715386 | TADA3 | transcriptional adaptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716397 | NPAS1 | neuronal PAS domain protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725328 | NFASC | neurofascin | ![]() |
![]() |
2 | 2 | ||||||
MIRT725503 | GANAB | glucosidase II alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT732913 | IRAK2 | interleukin 1 receptor associated kinase 2 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT734890 | SMAD3 | SMAD family member 3 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT737328 | LINC02476 | long intergenic non-protein coding RNA 2476 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT737544 | MALAT1 | metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) | ![]() |
![]() |
![]() |
![]() |
4 | 0 | ||||
MIRT755545 | PAK1 | p21 (RAC1) activated kinase 1 | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|