>BUB1|NM_004336|3'UTR
   1 AATTTGGATATAGACAGTCCTTAAAAATCACACTGTAAATATGAATCTGCTCACTTTAAACCTGTTTTTTTTTCATTTAT
  81 TGTTTATGTAAATGTTTGTTAAAAATAAATCCCATGGAATATTTCCATGTAACTTAGTTGTTATAAATATTTCAACAAAA
 161 TATACAACCCCATAAGGTCCCTATATAGCAGGCTGATTGGGCTGCTTCTGGGATGCAAGCATTTGTGAGAATAATTCAGA
 241 CATGAGCATTCTCTAGAAATCACTTT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agauUGUGGUGUCACACCAAac 5' |::: || || ||| Target 5' ttccATGTAACTTAGTTGTTat 3'	123 - 144	94.00	-6.00
2	miRNA 3' agauUGUGGUGUCACACCAAac 5' |:|: :||| || || Target 5' ccctATATAGCAGGCTGATTgg 3'	179 - 200	78.00	-6.10
3	miRNA 3' agaUUGUGGUGUCACAccaaac 5' || |:|||| ||| Target 5' ttaAAAATCACACTGTaaatat 3'	21 - 42	75.00	-5.61

Mutant ID	Mutant Position	Mutant Source
COSN31512023	12	COSMIC
COSN30123154	29	COSMIC
COSN30485107	54	COSMIC
COSN28842487	64	COSMIC
COSN30155973	74	COSMIC
COSN31492188	94	COSMIC
COSN30141859	112	COSMIC
COSN1777970	121	COSMIC
COSN30115409	123	COSMIC
COSN23337567	235	COSMIC
COSN1221617	242	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1341177560	2	dbSNP
rs781202575	3	dbSNP
rs757215922	4	dbSNP
rs751652650	7	dbSNP
rs1026865593	10	dbSNP
rs1156453790	14	dbSNP
rs1362124253	16	dbSNP
rs866272996	18	dbSNP
rs777886671	21	dbSNP
rs368415851	41	dbSNP
rs974004871	42	dbSNP
rs375754310	43	dbSNP
rs1311671807	49	dbSNP
rs1217364119	52	dbSNP
rs1326181979	53	dbSNP
rs1349929544	69	dbSNP
rs963345687	73	dbSNP
rs1307552270	74	dbSNP
rs1356041036	74	dbSNP
rs1380349272	74	dbSNP
rs528710907	74	dbSNP
rs1217664688	76	dbSNP
rs1279635238	77	dbSNP
rs1274307907	79	dbSNP
rs1437507237	82	dbSNP
rs1373460525	91	dbSNP
rs1329801354	92	dbSNP
rs1018010189	95	dbSNP
rs908709416	99	dbSNP
rs1238047079	110	dbSNP
rs992296947	111	dbSNP
rs1176480896	114	dbSNP
rs1381942412	133	dbSNP
rs1007597594	134	dbSNP
rs890527649	147	dbSNP
rs1401396423	154	dbSNP
rs1173203947	162	dbSNP
rs1422411963	164	dbSNP
rs756570200	168	dbSNP
rs1336709068	176	dbSNP
rs1030423503	177	dbSNP
rs1360193286	182	dbSNP
rs1413215875	183	dbSNP
rs1423920804	185	dbSNP
rs1329681441	189	dbSNP
rs1379605326	194	dbSNP
rs542553077	200	dbSNP
rs1241117385	207	dbSNP
rs1274524226	210	dbSNP
rs1342956624	217	dbSNP
rs960907450	231	dbSNP
rs998939982	234	dbSNP
rs1279433671	236	dbSNP
rs926897560	237	dbSNP
rs1196703956	239	dbSNP
rs980374328	240	dbSNP
rs573593471	242	dbSNP
rs1192618543	247	dbSNP
rs755657196	251	dbSNP
rs1455361941	252	dbSNP
rs1478814016	261	dbSNP
rs1009728232	266	dbSNP
rs1235967089	267	dbSNP
rs947624865	279	dbSNP
rs560442104	281	dbSNP
rs1177545932	296	dbSNP
rs894749258	296	dbSNP
rs553354407	298	dbSNP
rs1018753805	305	dbSNP
rs1169221707	307	dbSNP
rs1402869361	308	dbSNP
rs1448068763	314	dbSNP
rs1323127002	339	dbSNP
rs1329498547	340	dbSNP
rs1055867027	342	dbSNP
rs1458068958	342	dbSNP
rs5833370	343	dbSNP
rs1239716777	352	dbSNP
rs1207991528	362	dbSNP
rs1317396381	370	dbSNP
rs1441738426	370	dbSNP
rs1259992786	372	dbSNP
rs532665687	374	dbSNP
rs1219872765	376	dbSNP
rs1265010401	377	dbSNP
rs202051631	377	dbSNP
rs1491360125	378	dbSNP
rs1162967792	379	dbSNP
rs1192118370	379	dbSNP
rs1240995249	379	dbSNP
rs1324504389	379	dbSNP
rs1389062245	379	dbSNP
rs140482123	379	dbSNP
rs1407243778	379	dbSNP
rs1426479854	379	dbSNP
rs1466610600	379	dbSNP
rs1476576386	379	dbSNP
rs1491397338	379	dbSNP
rs386626691	379	dbSNP
rs938396692	379	dbSNP
rs1307355817	380	dbSNP
rs1474017718	380	dbSNP
rs1491422868	380	dbSNP
rs770654546	381	dbSNP
rs928342196	382	dbSNP
rs148892328	393	dbSNP
rs577680472	414	dbSNP
rs76529511	418	dbSNP
rs530828018	421	dbSNP
rs1359096468	423	dbSNP
rs181451932	429	dbSNP
rs1310538567	435	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.