>DNAJC28|NM_001040192|3'UTR
   1 TGTTTACTATCATAAATCATTCTTAGTTCCACTGACACTTTACATGGAAAATGAGATTTATTGCTATAATACAAGAATTT
  81 AAGAATTGTGCCATTGTACTTATCACAAAACTAATCACATAGCCAATGATGTGTGAGTGAGAAACCTATCAGGTTTGTCC
 161 TGAGGATATAGC

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' accUGCAAACGUCCCCUCCacc 5' | |||||: |||| Target 5' atcAGGTTTGT-CCTGAGGata 3'	148 - 168	82.00	-8.12

Mutant ID	Mutant Position	Mutant Source
COSN30491275	29	COSMIC
COSN2517065	39	COSMIC
COSN2517064	43	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1229291696	7	dbSNP
rs745934033	8	dbSNP
rs1270373602	9	dbSNP
rs774449561	11	dbSNP
rs771365218	24	dbSNP
rs1203530056	25	dbSNP
rs534560693	27	dbSNP
rs373451141	34	dbSNP
rs778313340	36	dbSNP
rs1033798340	37	dbSNP
rs756498209	38	dbSNP
rs748504016	44	dbSNP
rs757834589	48	dbSNP
rs1285748270	51	dbSNP
rs1002608190	54	dbSNP
rs1222673134	58	dbSNP
rs962782459	66	dbSNP
rs1360818639	71	dbSNP
rs570372214	72	dbSNP
rs1289531334	75	dbSNP
rs1296497536	80	dbSNP
rs1048134965	82	dbSNP
rs1241997952	94	dbSNP
rs1317258918	100	dbSNP
rs142250208	103	dbSNP
rs1389872505	104	dbSNP
rs1410599436	104	dbSNP
rs370459473	111	dbSNP
rs373953010	111	dbSNP
rs1303764040	115	dbSNP
rs930807962	118	dbSNP
rs1404428465	119	dbSNP
rs1364203261	123	dbSNP
rs1279831399	125	dbSNP
rs920732882	147	dbSNP
rs1300625409	150	dbSNP
rs1203064838	153	dbSNP
rs1454804098	160	dbSNP
rs1363562579	163	dbSNP
rs1036635737	165	dbSNP
rs1157451846	169	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.