pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4316 |
Genomic Coordinates | chr17: 77396984 - 77397054 |
Description | Homo sapiens miR-4316 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4316 | |||||||||
Sequence | 11| GGUGAGGCUAGCUGGUG |27 | |||||||||
Evidence | Experimental | |||||||||
Experiments | SOLiD | |||||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | NUP155 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | ATFB15, N155 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | nucleoporin 155 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_004298 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_153485 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on NUP155 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of NUP155 (miRNA target sites are highlighted) |
>NUP155|NM_004298|3'UTR 1 TTACTGTGATATACTTTCATCCGTTTTATGATCTGTAAAATAAAAACTCAGCTGGGTCCAGATATCAGGTGTTCTAAATC 81 TAAGAATGTAAGAACAATCTTAATAGAAATATGTTTTTAATAAGTGGCTAATATCTACAAATAGTACCTTTGCTAAATGA 161 ATTCTTTTTTATGACTATTTTGTTTTTTAGTAATTGGGTGAAAAAACAACTGAAATGAGATTATTTATTATTTTAACATA 241 AGGATTAAAAAAATTTAGAAACTCTTAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 9631.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Prostate Tissue | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM714647 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / mildMNase, repB |
Location of target site | ENST00000231498.3 | 3UTR | GUGCGAUCCCGGCUCACUGCAACCUCUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
74 hsa-miR-4316 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT080624 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT095088 | SEC24A | SEC24 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT123331 | CALU | calumenin | ![]() |
![]() |
2 | 2 | ||||||
MIRT154964 | RRM2 | ribonucleotide reductase regulatory subunit M2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT370850 | TGFBR2 | transforming growth factor beta receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442955 | SGCD | sarcoglycan delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT448240 | ZNF774 | zinc finger protein 774 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451710 | OLR1 | oxidized low density lipoprotein receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452072 | ATP6V0B | ATPase H+ transporting V0 subunit b | ![]() |
![]() |
2 | 2 | ||||||
MIRT455665 | GLO1 | glyoxalase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT460354 | TXNDC16 | thioredoxin domain containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461908 | NECAB3 | N-terminal EF-hand calcium binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462047 | HOXC13 | homeobox C13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462735 | EFNB1 | ephrin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463409 | ZC3HAV1L | zinc finger CCCH-type containing, antiviral 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT464952 | TWIST1 | twist family bHLH transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465052 | TSR1 | TSR1, ribosome maturation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT467549 | SMARCD1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT470226 | PRRC2A | proline rich coiled-coil 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT474081 | LMBR1L | limb development membrane protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT474481 | KLHDC8B | kelch domain containing 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT474704 | KIF3A | kinesin family member 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT474897 | KCTD21 | potassium channel tetramerization domain containing 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475203 | IL2RB | interleukin 2 receptor subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT477664 | EFHD2 | EF-hand domain family member D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477775 | E2F3 | E2F transcription factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477940 | DPM2 | dolichyl-phosphate mannosyltransferase subunit 2, regulatory | ![]() |
![]() |
2 | 2 | ||||||
MIRT478224 | DDX52 | DExD-box helicase 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479904 | CCDC117 | coiled-coil domain containing 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480639 | BSCL2 | BSCL2, seipin lipid droplet biogenesis associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT482435 | ADM | adrenomedullin | ![]() |
![]() |
2 | 10 | ||||||
MIRT483908 | GNB1L | G protein subunit beta 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT484161 | FAM71B | family with sequence similarity 71 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT484405 | SNX19 | sorting nexin 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485426 | LASP1 | LIM and SH3 protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489788 | KRT80 | keratin 80 | ![]() |
![]() |
2 | 4 | ||||||
MIRT490813 | ASB1 | ankyrin repeat and SOCS box containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT491176 | LAMA5 | laminin subunit alpha 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491573 | HSDL1 | hydroxysteroid dehydrogenase like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492633 | PLXNA1 | plexin A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492984 | NAV1 | neuron navigator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496441 | RAB11FIP4 | RAB11 family interacting protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT501829 | NCOA3 | nuclear receptor coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT502165 | KIAA0195 | transmembrane protein 94 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508652 | DIABLO | diablo IAP-binding mitochondrial protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT509554 | ACTG1 | actin gamma 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT520033 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 6 | ||||||
MIRT523969 | DVL3 | dishevelled segment polarity protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526150 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530330 | ARHGAP1 | Rho GTPase activating protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539985 | SLC24A4 | solute carrier family 24 member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT540851 | NUP155 | nucleoporin 155 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542326 | LIMD1 | LIM domains containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558908 | CBX5 | chromobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563663 | SMC4 | structural maintenance of chromosomes 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565433 | SURF4 | surfeit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567773 | DGAT2 | diacylglycerol O-acyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615573 | NCS1 | neuronal calcium sensor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627336 | TTLL7 | tubulin tyrosine ligase like 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632965 | EIF2S3 | eukaryotic translation initiation factor 2 subunit gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT634307 | SNTN | sentan, cilia apical structure protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT641569 | RAX | retina and anterior neural fold homeobox | ![]() |
![]() |
2 | 2 | ||||||
MIRT660509 | ARL5A | ADP ribosylation factor like GTPase 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT662703 | C10orf111 | chromosome 10 open reading frame 111 | ![]() |
![]() |
2 | 4 | ||||||
MIRT663214 | ZNF277 | zinc finger protein 277 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665318 | YIPF4 | Yip1 domain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695264 | CD209 | CD209 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT696231 | LIN9 | lin-9 DREAM MuvB core complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT698867 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT702700 | IPO9 | importin 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704236 | DHDDS | dehydrodolichyl diphosphate synthase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT704935 | CCDC120 | coiled-coil domain containing 120 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724285 | KCNMB1 | potassium calcium-activated channel subfamily M regulatory beta subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT735579 | VEGFA | vascular endothelial growth factor A | ![]() |
![]() |
![]() |
3 | 0 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|