miRTarBase - #MIRT540892


—
pre-miRNA Information
pre-miRNA hsa-mir-378g   
Genomic Coordinates chr1: 94745860 - 94745900
Description Homo sapiens miR-378g stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-378g
Sequence 2| ACUGGGCUUGGAGUCAGAAG |21
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SRSF9   
Synonyms SFRS9, SRp30c
Description serine and arginine rich splicing factor 9
Transcript NM_003769   
Expression
Putative miRNA Targets on SRSF9
3'UTR of SRSF9
(miRNA target sites are highlighted)		 
>SRSF9|NM_003769|3'UTR
   1 GACAGGTGATGGGAATTTTTTCTTTATTTTTTAGGTTAACTGAGCTGCTTTGTGCTCAGAATCTACATTCCAGATTGAGG
  81 ATTTAGTGTCTTAGGAAATTTTTTTAATTTTTTTTTTTTAAAGAAGAAAAAAAACTACATAATTTCTACCAGGGCCATAT
 161 TAGCAGTGAAACATTTTAAACTGCAGAAATTGTGGTTTTGGTTCAGAAACAAGTTGTATATTTTTCACCCCTGATTATGG
 241 GAAAAAAATCAGTTCTGTCTTTGTGGGTTGCTCTACTATGGAGATCAACAGTTACTGTGACTGAGTCGGCCCATTCTGTT
 321 TAGAAATATATTTTAAATGTTTAGTAATTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaaGACUGAGGUUCGGGUca 5'
             |||| ||  :|||||  
Target 5' tgaCTGAGTC--GGCCCAtt 3'
 298 - 315 121.00 -13.90
2 
miRNA  3' gaAGACUGAGGU-UCGGGUCa 5'
            || || ||:| | :|||| 
Target 5' gcTCAGAATCTACATTCCAGa 3'
 54 - 74 114.00 -8.40
3 
miRNA  3' gaAGACUGAGGUUCGGGUCa 5'
            | ||::|:: :|::||| 
Target 5' atTGTGGTTTT-GGTTCAGa 3'
 189 - 207 105.00 -10.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30509074 8 COSMIC
COSN30110756 15 COSMIC
COSN30173232 15 COSMIC
COSN31489022 22 COSMIC
COSN26996868 26 COSMIC
COSN26548957 40 COSMIC
COSN17874623 96 COSMIC
COSN26996870 97 COSMIC
COSN31522319 100 COSMIC
COSN31581879 101 COSMIC
COSN32052197 103 COSMIC
COSN26632641 106 COSMIC
COSN19659764 107 COSMIC
COSN26633008 107 COSMIC
COSN27200838 126 COSMIC
COSN24297051 127 COSMIC
COSN23987530 131 COSMIC
COSN5932616 137 COSMIC
COSN30138147 156 COSMIC
COSN30529630 197 COSMIC
COSN31600340 222 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1353927987 9 dbSNP
rs781270406 11 dbSNP
rs755150306 15 dbSNP
rs1352575354 18 dbSNP
rs1306425293 19 dbSNP
rs751817320 20 dbSNP
rs1176618236 22 dbSNP
rs780370849 23 dbSNP
rs758851796 25 dbSNP
rs1298698738 26 dbSNP
rs1386719095 32 dbSNP
rs1388963430 33 dbSNP
rs758963911 33 dbSNP
rs376520463 36 dbSNP
rs1454483547 37 dbSNP
rs1254136523 41 dbSNP
rs1379983677 44 dbSNP
rs146381618 47 dbSNP
rs372204543 50 dbSNP
rs750852833 50 dbSNP
rs999382570 63 dbSNP
rs201309578 65 dbSNP
rs1221531797 71 dbSNP
rs868453697 72 dbSNP
rs763778308 73 dbSNP
rs1320480250 77 dbSNP
rs1019282488 90 dbSNP
rs1205595314 95 dbSNP
rs1357036940 101 dbSNP
rs1255926630 102 dbSNP
rs528770912 105 dbSNP
rs1202695538 106 dbSNP
rs1257016654 106 dbSNP
rs1191819417 108 dbSNP
rs1477520427 108 dbSNP
rs1021935175 120 dbSNP
rs200337069 120 dbSNP
rs34136998 120 dbSNP
rs1224276423 123 dbSNP
rs1376847953 123 dbSNP
rs1372457554 126 dbSNP
rs1277916764 131 dbSNP
rs1011848660 135 dbSNP
rs1304490280 135 dbSNP
rs1346432867 136 dbSNP
rs895429060 157 dbSNP
rs1341918664 164 dbSNP
rs1214793794 166 dbSNP
rs1301085396 172 dbSNP
rs1270427817 178 dbSNP
rs142287809 210 dbSNP
rs1236126308 216 dbSNP
rs939573151 219 dbSNP
rs1488018862 226 dbSNP
rs1422927535 228 dbSNP
rs1048163653 229 dbSNP
rs995031663 231 dbSNP
rs1037170307 233 dbSNP
rs1190813288 233 dbSNP
rs1431200446 236 dbSNP
rs1178177417 240 dbSNP
rs1395556282 242 dbSNP
rs941457515 244 dbSNP
rs1400694685 249 dbSNP
rs899313320 255 dbSNP
rs1361882293 256 dbSNP
rs746547284 257 dbSNP
rs1156363378 261 dbSNP
rs1292554715 265 dbSNP
rs1365971218 275 dbSNP
rs909947307 277 dbSNP
rs1036507635 286 dbSNP
rs1353530569 287 dbSNP
rs1481117323 290 dbSNP
rs985483306 290 dbSNP
rs1268916331 297 dbSNP
rs114832191 301 dbSNP
rs921880364 303 dbSNP
rs1487261491 304 dbSNP
rs976402933 307 dbSNP
rs775160638 308 dbSNP
rs1245159897 309 dbSNP
rs928172161 311 dbSNP
rs1046396799 312 dbSNP
rs529010748 320 dbSNP
rs1316338109 328 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8683.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase "PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaagacugagguUCGGGUCa 5'
                      ||||||| 
Target 5' ------------AGCCCAGg 3'
 		1 - 8
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000229390.3 | 3UTR | GAGCCCAGGAGUUGGAGGCUGCAGUGAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000229390.3 | 3UTR | AGCCCAGGAGUUGGAGGCUGCAGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
68 hsa-miR-378g Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT444739 SMYD1 SET and MYND domain containing 1 2 2
MIRT456104 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT458683 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT465802 TMEM91 transmembrane protein 91 2 2
MIRT470843 PLXND1 plexin D1 2 2
MIRT497263 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497674 SYNGR1 synaptogyrin 1 2 2
MIRT498218 TLN2 talin 2 2 2
MIRT498309 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504046 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT518196 CLEC4E C-type lectin domain family 4 member E 2 2
MIRT533143 WNT10A Wnt family member 10A 2 2
MIRT533540 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533679 TMEM86A transmembrane protein 86A 2 2
MIRT540892 SRSF9 serine and arginine rich splicing factor 9 2 2
MIRT541329 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT541850 PLIN5 perilipin 5 2 2
MIRT551431 F2 coagulation factor II, thrombin 2 2
MIRT552105 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT564912 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568605 ACVR2A activin A receptor type 2A 2 2
MIRT572604 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT574234 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT575688 Map1b microtubule-associated protein 1B 2 2
MIRT576643 Mill2 MHC I like leukocyte 2 1 1
MIRT609877 RAD54L2 RAD54 like 2 2 4
MIRT610057 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610791 KLK2 kallikrein related peptidase 2 2 2
MIRT617175 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT617707 RUSC2 RUN and SH3 domain containing 2 2 2
MIRT620577 WBSCR27 methyltransferase like 27 2 4
MIRT622657 POU2F3 POU class 2 homeobox 3 2 4
MIRT624561 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT634255 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634677 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT635254 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT637081 SELPLG selectin P ligand 2 2
MIRT639021 AAK1 AP2 associated kinase 1 2 2
MIRT640396 ZNF785 zinc finger protein 785 2 2
MIRT642441 CLUAP1 clusterin associated protein 1 2 2
MIRT645666 ADK adenosine kinase 2 2
MIRT646083 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT650513 UFM1 ubiquitin fold modifier 1 2 2
MIRT652474 TMEM181 transmembrane protein 181 2 2
MIRT652584 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654763 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 2
MIRT655200 PHAX phosphorylated adaptor for RNA export 2 2
MIRT658353 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT661820 PRPSAP1 phosphoribosyl pyrophosphate synthetase associated protein 1 2 2
MIRT662190 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT664375 CYB5A cytochrome b5 type A 2 2
MIRT665025 ELK1 ELK1, ETS transcription factor 2 2
MIRT666492 SBNO1 strawberry notch homolog 1 2 2
MIRT668480 EXOSC2 exosome component 2 2 2
MIRT682768 TMEM120B transmembrane protein 120B 2 2
MIRT689628 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT691846 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT696490 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT712480 FSTL3 follistatin like 3 2 2
MIRT712780 ZNF154 zinc finger protein 154 2 2
MIRT716607 MPPED1 metallophosphoesterase domain containing 1 2 2
MIRT719357 ITPKB inositol-trisphosphate 3-kinase B 2 2
MIRT719739 SLC39A11 solute carrier family 39 member 11 2 2
MIRT722569 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722838 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT733138 LINC00963 long intergenic non-protein coding RNA 963 3 0
MIRT733139 CHI3L1 chitinase 3 like 1 3 0
MIRT736944 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-378g Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-378g Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib + Trametinib sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line
hsa-mir-378g Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-378g Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-378g Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-378g Tripterygium wilfordii Hook F resistant tissue
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-378g Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-378g Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-378g Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission