>OIP5|NM_007280|3'UTR
   1 TCCTGTACCAAAGCTTGAGTGTCAGGTTCAGGCTTTATTGCTGTCTTCAACAACAGGTGCTGCTTAGTCATTTCTTGAAA
  81 AAGATTGGCTTCAAGAATGGAGGGGAAATGCAGTTTCTATTTACCTTTAGGCTGATTTTCCAAATTATTTGTGAAGCTGT
 161 TTTTAGAAGATGAGAGACTAAGGATTCTTCTCTTTTATAGCTATTTGCCTTAAGAACTTACTTTAGATTCTTATTGAATT
 241 CATAATACTTATCTCTGAAAATGTCTTTGACTGTAAATTTAGGAATTAAGATGCAGAGTCCCATGTGTCCTCTGATCTAA
 321 AGTTGCATGGTTGGTCTGAAAATAGAGTTGGGCTTAATGTTGACTTCTATTACTCCTGCATGGAGCAGTTGTTATGAATA
 401 CTAATACATCACTTTTTAACTTCTGTAAAATACAGATCATAATATTCTATAGGTAATGTTTAATAAATTGCCTGAATAAT
 481 ATACAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cguGAGUU-UGACACCCCCGUGAa 5' :|||| | || |||| | | Target 5' ggcTTCAAGAATGGAGGGGAAATg 3'	87 - 110	100.00	-14.23
2	miRNA 3' cguGAGUUUGA-CAC-CCCCGugaa 5' || ||| | | | |||| Target 5' ggtCTGAAAATAGAGTTGGGCttaa 3'	333 - 357	92.00	-6.16
3	miRNA 3' cgUGAGUUUGAC--ACCCCCGUGAa 5' |||| ||| | || ||| | Target 5' ttACTC---CTGCAT-GGAGCAGTt 3'	370 - 390	91.00	-10.50

Mutant ID	Mutant Position	Mutant Source
COSN30473749	33	COSMIC
COSN21237638	45	COSMIC
COSN30465008	56	COSMIC
COSN509790	105	COSMIC
COSN28861890	257	COSMIC
COSN22039620	311	COSMIC
COSN22545655	367	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs746045476	3	dbSNP
rs1372876994	9	dbSNP
rs1171765451	13	dbSNP
rs1412585926	13	dbSNP
rs1479125618	15	dbSNP
rs1416285226	18	dbSNP
rs779224961	19	dbSNP
rs886979666	20	dbSNP
rs369999957	21	dbSNP
rs777623267	26	dbSNP
rs756041383	31	dbSNP
rs752690691	38	dbSNP
rs780549481	48	dbSNP
rs539236117	53	dbSNP
rs1162700716	54	dbSNP
rs1020448965	56	dbSNP
rs1317961001	57	dbSNP
rs1332382513	64	dbSNP
rs1436552215	68	dbSNP
rs868008277	69	dbSNP
rs1276006678	83	dbSNP
rs750000747	83	dbSNP
rs530171073	85	dbSNP
rs867273568	86	dbSNP
rs899136394	104	dbSNP
rs1270353456	108	dbSNP
rs1330089325	112	dbSNP
rs1208416757	119	dbSNP
rs1259899209	121	dbSNP
rs1453448280	128	dbSNP
rs1199630123	129	dbSNP
rs1246086482	143	dbSNP
rs1479387404	164	dbSNP
rs1161114909	166	dbSNP
rs561066097	172	dbSNP
rs1039029484	173	dbSNP
rs943398550	174	dbSNP
rs74012259	209	dbSNP
rs900490991	214	dbSNP
rs1240603561	217	dbSNP
rs1192809824	226	dbSNP
rs1051892154	234	dbSNP
rs74012258	237	dbSNP
rs115325774	251	dbSNP
rs1047649575	265	dbSNP
rs1334771617	269	dbSNP
rs1259223202	271	dbSNP
rs1273226578	291	dbSNP
rs979391065	293	dbSNP
rs1229555477	297	dbSNP
rs1289166228	312	dbSNP
rs1489839589	314	dbSNP
rs770839588	317	dbSNP
rs915555460	335	dbSNP
rs1269193436	350	dbSNP
rs545422681	358	dbSNP
rs146239241	360	dbSNP
rs1367080605	361	dbSNP
rs1369863796	365	dbSNP
rs991131917	369	dbSNP
rs959720337	378	dbSNP
rs1363246031	380	dbSNP
rs1035431196	383	dbSNP
rs982591857	391	dbSNP
rs183523074	401	dbSNP
rs1395173786	407	dbSNP
rs1409631998	420	dbSNP
rs1305244863	421	dbSNP
rs951248652	432	dbSNP
rs1245706400	435	dbSNP
rs1283810007	444	dbSNP
rs924927886	468	dbSNP
rs1324231367	469	dbSNP
rs1026826424	476	dbSNP
rs543221614	478	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.