pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4524a |
Genomic Coordinates | chr17: 69099564 - 69099632 |
Description | Homo sapiens miR-4524a stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4524a-5p | ||||||||||||
Sequence | 6| AUAGCAGCAUGAACCUGUCUCA |27 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Illumina | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CBX4 | ||||||||||||||||||||
Synonyms | NBP16, PC2 | ||||||||||||||||||||
Description | chromobox 4 | ||||||||||||||||||||
Transcript | NM_003655 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CBX4 | |||||||||||||||||||||
3'UTR of CBX4 (miRNA target sites are highlighted) |
>CBX4|NM_003655|3'UTR 1 CCGGAGGGCGTCGGAAGGGGAAGCGCCATTCCCGCGGGGGGGCGGGGAGCTGAGCACCTGGGGCCTCGGGGCGGGCTCCC 81 CTCTCGCCAACCCGCCAACCGCGAGAGACCCAGGCTGGCCCCCAGGGTGAGGACGCCCGGAGCGGAGGTAACCATGTTCC 161 CCCTGCGGCGGCTGTCAGACCTGGGCGGAGGCCCCTTCCACGCGGTGCCGGCGGGGCTCGCCCTCTCCTGCCCTTCCCCG 241 CTGGAGATGGACCCCCGGAACGGACAGGGCAGCTCTGCGCCCGGCCTCAGAGTTCTAGTATTATATTTTAACCGTGCTAA 321 CTTGTCAAGTGCTGACTCTACTCCCGTTTGTACGTGGTGTTATTATTGAAATGTATTGTTTGAGCTCAAAAGGCCCGACC 401 ACCCCCCTTCGGGCTGCTATATATATATTTATTTGTAGGTATTTATATATTGAAATATAAAAACCTAGATTTATGGAGTT 481 TCCTCTAGATCATGTTATATTCTATATCAGACAAACTATTTTCTTTTGACCTTTCTTCCCCTCCATCCAGTATTTCGGTT 561 GATTTCATTTTCTCCCCTCTCTTCCCCTTCCACGAACTGCAATACCAGTAACCTTGGTATATATTTTTTGATACTGTACA 641 CATGGATGTCTTGTTTCTATGTGCAAAAAAAAAAAAAAAAAAAAGTTTGTTAAAAGGCTACACGAGCTCTCTAGAAACTG 721 CTGCTACTAGAAATGTCTAAACTATAAGCTTCCAACTATTACCTGCTTGAATGTAAATATTAAATGGAGATGTTGAAGGT 801 GCAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 8535.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM714647 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / mildMNase, repB |
Location of target site | ENST00000269397.4 | 3UTR | UUAAAAGGCUACACGAGCUCUCUAGAAACUGCUGCUACUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
180 hsa-miR-4524a-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT055251 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT055826 | PLEKHA1 | pleckstrin homology domain containing A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT060573 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT061013 | C1ORF21 | chromosome 1 open reading frame 21 | ![]() |
![]() |
2 | 6 | ||||||
MIRT064694 | CCND2 | cyclin D2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT075268 | SNTB2 | syntrophin beta 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT079668 | NAPG | NSF attachment protein gamma | ![]() |
![]() |
2 | 12 | ||||||
MIRT081651 | CCNE1 | cyclin E1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT082996 | PNPLA6 | patatin like phospholipase domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT083463 | RALGAPB | Ral GTPase activating protein non-catalytic beta subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT085755 | RIF1 | replication timing regulatory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT086022 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT087431 | ZNRF3 | zinc and ring finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT088786 | SOCS5 | suppressor of cytokine signaling 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT089221 | ACTR2 | ARP2 actin related protein 2 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT093696 | PI4K2B | phosphatidylinositol 4-kinase type 2 beta | ![]() |
![]() |
2 | 6 | ||||||
MIRT095090 | SEC24A | SEC24 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT096249 | CANX | calnexin | ![]() |
![]() |
2 | 2 | ||||||
MIRT100215 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT100746 | VEGFA | vascular endothelial growth factor A | ![]() |
![]() |
2 | 12 | ||||||
MIRT100904 | CD2AP | CD2 associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT102647 | UBN2 | ubinuclein 2 | ![]() |
![]() |
2 | 10 | ||||||
MIRT103882 | FOXK1 | forkhead box K1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT104246 | DMTF1 | cyclin D binding myb like transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT106310 | ZFHX4 | zinc finger homeobox 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT107696 | RECK | reversion inducing cysteine rich protein with kazal motifs | ![]() |
![]() |
2 | 2 | ||||||
MIRT114943 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT117671 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT133799 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT140167 | SPRED1 | sprouty related EVH1 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT142279 | DCTN5 | dynactin subunit 5 | ![]() |
![]() |
2 | 8 | ||||||
MIRT143288 | N4BP1 | NEDD4 binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT165939 | CREBRF | CREB3 regulatory factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT175251 | PSAT1 | phosphoserine aminotransferase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT186381 | PNRC2 | proline rich nuclear receptor coactivator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT191470 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT196480 | TAOK1 | TAO kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT201470 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT204615 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | ![]() |
![]() |
2 | 8 | ||||||
MIRT204646 | MOB4 | MOB family member 4, phocein | ![]() |
![]() |
2 | 8 | ||||||
MIRT204749 | BZW1 | basic leucine zipper and W2 domains 1 | ![]() |
![]() |
2 | 12 | ||||||
MIRT206031 | NUP50 | nucleoporin 50 | ![]() |
![]() |
2 | 6 | ||||||
MIRT211196 | FGF2 | fibroblast growth factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT229353 | ZNF449 | zinc finger protein 449 | ![]() |
![]() |
2 | 2 | ||||||
MIRT247138 | WEE1 | WEE1 G2 checkpoint kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT249461 | ZNF691 | zinc finger protein 691 | ![]() |
![]() |
2 | 4 | ||||||
MIRT256314 | CDC42SE2 | CDC42 small effector 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT258419 | WIPI2 | WD repeat domain, phosphoinositide interacting 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT265083 | CHEK1 | checkpoint kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT270561 | SETD1B | SET domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT274749 | RAB3IP | RAB3A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT277515 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | ![]() |
![]() |
2 | 4 | ||||||
MIRT289642 | CBX2 | chromobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT301001 | MTMR3 | myotubularin related protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT307149 | CTDSPL | CTD small phosphatase like | ![]() |
![]() |
2 | 4 | ||||||
MIRT309021 | USP53 | ubiquitin specific peptidase 53 | ![]() |
![]() |
2 | 2 | ||||||
MIRT314100 | PIK3R1 | phosphoinositide-3-kinase regulatory subunit 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT319338 | CAPZA2 | capping actin protein of muscle Z-line alpha subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT320619 | ZNRF2 | zinc and ring finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT324285 | LURAP1L | leucine rich adaptor protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT446498 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448437 | TLL1 | tolloid like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461537 | ACTR3B | ARP3 actin related protein 3 homolog B | ![]() |
![]() |
2 | 2 | ||||||
MIRT463162 | ZNF367 | zinc finger protein 367 | ![]() |
![]() |
2 | 10 | ||||||
MIRT463493 | ZC3H10 | zinc finger CCCH-type containing 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465154 | TSC22D2 | TSC22 domain family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466418 | TFAP2A | transcription factor AP-2 alpha | ![]() |
![]() |
2 | 8 | ||||||
MIRT468278 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469399 | REL | REL proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 6 | ||||||
MIRT471941 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473688 | MAPK8 | mitogen-activated protein kinase 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT479618 | CDC25A | cell division cycle 25A | ![]() |
![]() |
2 | 2 | ||||||
MIRT482098 | AKT3 | AKT serine/threonine kinase 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483995 | ATAD5 | ATPase family, AAA domain containing 5 | ![]() |
![]() |
2 | 12 | ||||||
MIRT485205 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | ![]() |
![]() |
2 | 8 | ||||||
MIRT498763 | C3orf38 | chromosome 3 open reading frame 38 | ![]() |
![]() |
2 | 8 | ||||||
MIRT498961 | ORC4 | origin recognition complex subunit 4 | ![]() |
![]() |
2 | 8 | ||||||
MIRT499440 | ODF2L | outer dense fiber of sperm tails 2 like | ![]() |
![]() |
2 | 8 | ||||||
MIRT500080 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | ![]() |
![]() |
2 | 8 | ||||||
MIRT500305 | ZNF622 | zinc finger protein 622 | ![]() |
![]() |
2 | 8 | ||||||
MIRT500410 | ZMAT3 | zinc finger matrin-type 3 | ![]() |
![]() |
2 | 8 | ||||||
MIRT500789 | TLK1 | tousled like kinase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT500930 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 6 | ||||||
MIRT500943 | SREK1 | splicing regulatory glutamic acid and lysine rich protein 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT501068 | SMAD7 | SMAD family member 7 | ![]() |
![]() |
2 | 8 | ||||||
MIRT501711 | PARD6B | par-6 family cell polarity regulator beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT502627 | DDX3X | DEAD-box helicase 3, X-linked | ![]() |
![]() |
2 | 8 | ||||||
MIRT502910 | CDCA4 | cell division cycle associated 4 | ![]() |
![]() |
2 | 8 | ||||||
MIRT502935 | CDC37L1 | cell division cycle 37 like 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT504531 | ZNF620 | zinc finger protein 620 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505106 | YTHDC1 | YTH domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505337 | TMEM245 | transmembrane protein 245 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505383 | TMEM100 | transmembrane protein 100 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505678 | SESTD1 | SEC14 and spectrin domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT506157 | PLAG1 | PLAG1 zinc finger | ![]() |
![]() |
2 | 8 | ||||||
MIRT506183 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT506475 | MYO5A | myosin VA | ![]() |
![]() |
2 | 6 | ||||||
MIRT506826 | KIF23 | kinesin family member 23 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507160 | GAS2L3 | growth arrest specific 2 like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507511 | DYNLL2 | dynein light chain LC8-type 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT507845 | CCNE2 | cyclin E2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510403 | ZNF507 | zinc finger protein 507 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518078 | TRIM35 | tripartite motif containing 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518982 | NNT | nicotinamide nucleotide transhydrogenase | ![]() |
![]() |
2 | 4 | ||||||
MIRT521045 | SLC2A3 | solute carrier family 2 member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT521190 | SBNO1 | strawberry notch homolog 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT522088 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT524846 | ARPP19 | cAMP regulated phosphoprotein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527787 | TMEM44 | transmembrane protein 44 | ![]() |
![]() |
2 | 4 | ||||||
MIRT537803 | EFNB2 | ephrin B2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT540830 | GNAT1 | G protein subunit alpha transducin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT541140 | PISD | phosphatidylserine decarboxylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT541419 | CBX4 | chromobox 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543517 | PRSS21 | protease, serine 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543824 | GSG1 | germ cell associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544959 | UGT2B4 | UDP glucuronosyltransferase family 2 member B4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545179 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT545335 | CCDC83 | coiled-coil domain containing 83 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545518 | RSL24D1 | ribosomal L24 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545670 | DECR1 | 2,4-dienoyl-CoA reductase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545931 | ZBTB44 | zinc finger and BTB domain containing 44 | ![]() |
![]() |
2 | 4 | ||||||
MIRT546102 | USP48 | ubiquitin specific peptidase 48 | ![]() |
![]() |
2 | 4 | ||||||
MIRT546598 | SALL1 | spalt like transcription factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT546626 | RTN4 | reticulon 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547651 | KPNA3 | karyopherin subunit alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547987 | HCFC2 | host cell factor C2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548717 | CRK | CRK proto-oncogene, adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT548931 | CDK17 | cyclin dependent kinase 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549067 | CACUL1 | CDK2 associated cullin domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549266 | ASH1L | ASH1 like histone lysine methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT550460 | OSCAR | osteoclast associated, immunoglobulin-like receptor | ![]() |
![]() |
2 | 4 | ||||||
MIRT550806 | FAM229B | family with sequence similarity 229 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT552024 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552334 | ZNF704 | zinc finger protein 704 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552732 | YRDC | yrdC N6-threonylcarbamoyltransferase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT553795 | SZRD1 | SUZ RNA binding domain containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554694 | RNF149 | ring finger protein 149 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555133 | PTPRD | protein tyrosine phosphatase, receptor type D | ![]() |
![]() |
2 | 2 | ||||||
MIRT555264 | PRDM4 | PR/SET domain 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556848 | KANK1 | KN motif and ankyrin repeat domains 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT557474 | GPR27 | G protein-coupled receptor 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT558018 | EXT1 | exostosin glycosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558498 | CYP26B1 | cytochrome P450 family 26 subfamily B member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT558579 | CREBL2 | cAMP responsive element binding protein like 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT558610 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT558650 | CNKSR3 | CNKSR family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558986 | CA8 | carbonic anhydrase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559141 | BTN3A3 | butyrophilin subfamily 3 member A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559327 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) | ![]() |
![]() |
2 | 2 | ||||||
MIRT562021 | LANCL1 | LanC like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562869 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563074 | SLC25A12 | solute carrier family 25 member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563496 | DLGAP3 | DLG associated protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563890 | RAPH1 | Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564311 | CCNT1 | cyclin T1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564942 | XKR7 | XK related 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564979 | WNK3 | WNK lysine deficient protein kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565423 | TEF | TEF, PAR bZIP transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT566824 | MAP3K7 | mitogen-activated protein kinase kinase kinase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571961 | KIF5B | kinesin family member 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT575877 | Cask | calcium/calmodulin-dependent serine protein kinase (MAGUK family) | ![]() |
![]() |
2 | 3 | ||||||
MIRT576523 | Txlna | taxilin alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT614693 | TRAK1 | trafficking kinesin protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616065 | ZC3H14 | zinc finger CCCH-type containing 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618838 | ASAH2B | N-acylsphingosine amidohydrolase 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT624626 | ATXN2 | ataxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624652 | ASAH2 | N-acylsphingosine amidohydrolase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640314 | MMAB | methylmalonic aciduria (cobalamin deficiency) cblB type | ![]() |
![]() |
2 | 2 | ||||||
MIRT659248 | CUL3 | cullin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680972 | DCAF17 | DDB1 and CUL4 associated factor 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682261 | RS1 | retinoschisin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682505 | GLP2R | glucagon like peptide 2 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT693904 | HNRNPA1L2 | heterogeneous nuclear ribonucleoprotein A1-like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699214 | SLCO3A1 | solute carrier organic anion transporter family member 3A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699373 | SLC30A6 | solute carrier family 30 member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699451 | SLC16A9 | solute carrier family 16 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701230 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT702849 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706163 | CASK | calcium/calmodulin dependent serine protein kinase | ![]() |
![]() |
2 | 3 | ||||||
MIRT718990 | UTP15 | UTP15, small subunit processome component | ![]() |
![]() |
2 | 2 |