miRTarBase - #MIRT541451


—
pre-miRNA Information
pre-miRNA hsa-mir-6509   
Genomic Coordinates chr7: 135206994 - 135207078
Description Homo sapiens miR-6509 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6509-3p
Sequence 52| UUCCACUGCCACUACCUAAUUU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs778601614 1 dbSNP
rs754554776 3 dbSNP
rs767798995 3 dbSNP
rs145322812 4 dbSNP
rs773941257 5 dbSNP
rs768273593 9 dbSNP
rs984565062 12 dbSNP
rs748872915 13 dbSNP
rs774861125 14 dbSNP
rs13241975 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C15orf48   
Synonyms FOAP-11, MIR147BHG, NMES1
Description chromosome 15 open reading frame 48
Transcript NM_032413   
Other Transcripts NM_197955   
Expression
Putative miRNA Targets on C15orf48
3'UTR of C15orf48
(miRNA target sites are highlighted)		 
>C15orf48|NM_032413|3'UTR
   1 CGAGCCCTCGCCTCTTTCTTCTGAAGAGTACTCTATAAATCTAGTGGAAACATTTCTGCACAAACTAGATTCTGGACACC
  81 AGTGTGCGGAAATGCTTCTGCTACATTTTTAGGGTTTGTCTACATTTTTTGGGCTCTGGATAAGGAATTAAAGGAGTGCA
 161 GCAATAACTGCACTGTCTAAAAGTTTGTGCTTATTTTCTTGTAAATTTGAATATTGCATATTGAAATTTTTGTTTATGAT
 241 CTATGAATGTTTTTCTTAAAATTTACAAAGCTTTGTAAATTAGATTTTCTTTAATAAAATGCCATTTGTGCAAGATTTCT
 321 CAAAGATTAGGTATATATTTAAATGGAAGAGAAAATATTTTTATGGGAGAAAAATACATTTGAACCATGAAATTTCATCT
 401 TTTAAATAACATCCAGTACAGATTTCTGTGTAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuuaauccaucaccGUCACCUu 5'
                        :|||||| 
Target 5' gtactctataaatcTAGTGGAa 3'
 28 - 49 124.00 -9.10
2 
miRNA  3' uuUAAUCCAUCACC----GUCACcuu 5'
            | ||| |  |||    |||||   
Target 5' aaACTAGATTCTGGACACCAGTGtgc 3'
 62 - 87 114.00 -5.90
3 
miRNA  3' uuUAAUCCAU---CACCGUCACCUu 5'
            ||||||||    |   | |||| 
Target 5' agATTAGGTATATATTTAAATGGAa 3'
 324 - 348 100.00 -10.93
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30663715 2 COSMIC
COSN30118451 10 COSMIC
COSN30178263 11 COSMIC
COSN31491409 19 COSMIC
COSN30145280 55 COSMIC
COSN19766453 59 COSMIC
COSN30578089 72 COSMIC
COSN30504280 88 COSMIC
COSN30491092 89 COSMIC
COSN26968364 104 COSMIC
COSN19668184 116 COSMIC
COSN30753588 127 COSMIC
COSN30644363 131 COSMIC
COSN31588441 135 COSMIC
COSN31575782 144 COSMIC
COSN30503296 153 COSMIC
COSN31538570 154 COSMIC
COSN31586505 186 COSMIC
COSN31600606 226 COSMIC
COSN1676667 254 COSMIC
COSN30133248 280 COSMIC
COSN31605088 290 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs146986038 1 dbSNP
rs755311175 2 dbSNP
rs746181694 3 dbSNP
rs1226725912 7 dbSNP
rs772439817 8 dbSNP
rs775907096 10 dbSNP
rs189209655 11 dbSNP
rs1227920900 12 dbSNP
rs949471910 13 dbSNP
rs1358289071 20 dbSNP
rs368356647 31 dbSNP
rs769265951 38 dbSNP
rs56073218 42 dbSNP
rs1207278343 43 dbSNP
rs1262987562 46 dbSNP
rs905249368 52 dbSNP
rs764757598 58 dbSNP
rs750125671 59 dbSNP
rs534037397 61 dbSNP
rs1162051411 65 dbSNP
rs766283112 68 dbSNP
rs1426785672 70 dbSNP
rs751470823 74 dbSNP
rs938181791 78 dbSNP
rs982827504 79 dbSNP
rs1158958748 80 dbSNP
rs1384117536 81 dbSNP
rs754846973 83 dbSNP
rs376183261 86 dbSNP
rs1347541319 87 dbSNP
rs1262406913 88 dbSNP
rs753817843 88 dbSNP
rs1053956663 89 dbSNP
rs1200410442 92 dbSNP
rs752984903 96 dbSNP
rs757376786 103 dbSNP
rs1486908611 104 dbSNP
rs1263800306 112 dbSNP
rs1220907030 125 dbSNP
rs1459989501 126 dbSNP
rs1241572667 131 dbSNP
rs779049093 133 dbSNP
rs553401452 135 dbSNP
rs570220533 140 dbSNP
rs1271688293 142 dbSNP
rs1275281133 145 dbSNP
rs539011319 147 dbSNP
rs1340236933 157 dbSNP
rs747451116 158 dbSNP
rs1384456729 159 dbSNP
rs769015091 160 dbSNP
rs777226880 163 dbSNP
rs1475275217 165 dbSNP
rs920543229 166 dbSNP
rs931855753 172 dbSNP
rs1409049181 176 dbSNP
rs138162319 178 dbSNP
rs894083842 182 dbSNP
rs1009809305 183 dbSNP
rs576015042 184 dbSNP
rs1159733513 194 dbSNP
rs1020603802 205 dbSNP
rs1463891459 210 dbSNP
rs1372249292 212 dbSNP
rs985826894 215 dbSNP
rs1430288818 220 dbSNP
rs1265173827 222 dbSNP
rs900868618 225 dbSNP
rs1445501322 228 dbSNP
rs1468919632 229 dbSNP
rs3803332 237 dbSNP
rs1196936845 254 dbSNP
rs1317484884 264 dbSNP
rs944460089 265 dbSNP
rs1230049594 285 dbSNP
rs1311025627 290 dbSNP
rs1301106067 297 dbSNP
rs9381 301 dbSNP
rs1356365368 304 dbSNP
rs1041474143 312 dbSNP
rs1409397234 316 dbSNP
rs902902771 317 dbSNP
rs1444177224 322 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 84419.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase "PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000344300.3 | 3UTR | UGGAAACAUUUCUGCACAAACUAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000344300.3 | 3UTR | UGGAAACAUUUCUGCACAAACUAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-6509-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055374 PDCD4 programmed cell death 4 2 4
MIRT378341 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT444668 CDKL2 cyclin dependent kinase like 2 2 2
MIRT446953 CD248 CD248 molecule 2 2
MIRT460332 CAMK4 calcium/calmodulin dependent protein kinase IV 2 6
MIRT464078 VPS4A vacuolar protein sorting 4 homolog A 2 2
MIRT464586 UBN2 ubinuclein 2 2 2
MIRT468482 SESN3 sestrin 3 2 2
MIRT468962 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT475455 HSPA8 heat shock protein family A (Hsp70) member 8 2 2
MIRT482403 ADRB1 adrenoceptor beta 1 2 10
MIRT486992 ZFAND2B zinc finger AN1-type containing 2B 2 2
MIRT489397 TUBB2A tubulin beta 2A class IIa 2 2
MIRT526319 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526560 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT526732 ZNF138 zinc finger protein 138 2 8
MIRT531581 STXBP5L syntaxin binding protein 5 like 2 2
MIRT532011 NOX5 NADPH oxidase 5 2 2
MIRT533407 TXLNG taxilin gamma 2 2
MIRT533436 TRPC5 transient receptor potential cation channel subfamily C member 5 2 2
MIRT533866 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT539254 ANKRD50 ankyrin repeat domain 50 2 2
MIRT541451 C15orf48 chromosome 15 open reading frame 48 2 2
MIRT566794 MIER3 MIER family member 3 2 2
MIRT569294 SURF6 surfeit 6 2 2
MIRT571336 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT572802 PPP3CB protein phosphatase 3 catalytic subunit beta 2 2
MIRT572813 MYO1C myosin IC 2 2
MIRT574219 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT607259 GRAMD1B GRAM domain containing 1B 2 4
MIRT609307 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT615459 REPS1 RALBP1 associated Eps domain containing 1 2 2
MIRT616861 RPLP1 ribosomal protein lateral stalk subunit P1 2 2
MIRT619415 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT619652 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT625325 TNFRSF13B TNF receptor superfamily member 13B 2 2
MIRT638980 ARFIP2 ADP ribosylation factor interacting protein 2 2 2
MIRT639458 ZNF429 zinc finger protein 429 2 2
MIRT640550 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT641473 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT642720 ATXN3 ataxin 3 2 2
MIRT643048 SMN1 survival of motor neuron 1, telomeric 2 2
MIRT644921 SMN2 survival of motor neuron 2, centromeric 2 2
MIRT645875 ZNF275 zinc finger protein 275 2 2
MIRT649824 LIPG lipase G, endothelial type 2 2
MIRT649851 GYS2 glycogen synthase 2 2 2
MIRT649972 TRAFD1 TRAF-type zinc finger domain containing 1 2 2
MIRT650675 ZNF259 ZPR1 zinc finger 1 1
MIRT651319 ZCCHC2 zinc finger CCHC-type containing 2 2 2
MIRT652876 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT652881 SYVN1 synoviolin 1 2 2
MIRT654144 RPAP2 RNA polymerase II associated protein 2 2 2
MIRT657080 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT657181 INO80C INO80 complex subunit C 2 2
MIRT657830 GJD3 gap junction protein delta 3 2 2
MIRT657897 GDF7 growth differentiation factor 7 2 2
MIRT659631 CDKN2AIP CDKN2A interacting protein 2 2
MIRT663115 SPTA1 spectrin alpha, erythrocytic 1 2 2
MIRT664739 METTL16 methyltransferase like 16 2 2
MIRT667551 LRAT lecithin retinol acyltransferase 2 2
MIRT668552 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT682893 XIAP X-linked inhibitor of apoptosis 2 2
MIRT683092 PRRG4 proline rich and Gla domain 4 2 2
MIRT683102 TIMM10B translocase of inner mitochondrial membrane 10B 2 2
MIRT697648 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT709158 ZNF419 zinc finger protein 419 2 2
MIRT713220 RCAN2 regulator of calcineurin 2 2 2
MIRT713277 LAIR1 leukocyte associated immunoglobulin like receptor 1 2 2
MIRT715008 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT715051 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT715696 PNMAL2 paraneoplastic Ma antigen family member 8B 2 2
MIRT717250 TMEM246 transmembrane protein 246 2 2
MIRT717322 PGK1 phosphoglycerate kinase 1 2 2
MIRT717587 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 2
MIRT718122 CHST4 carbohydrate sulfotransferase 4 2 2
MIRT718418 CALN1 calneuron 1 2 2
MIRT718750 ZNF490 zinc finger protein 490 2 2
MIRT720048 PPP1R3F protein phosphatase 1 regulatory subunit 3F 2 2
MIRT721497 THRB thyroid hormone receptor beta 2 2
MIRT722531 EPRS glutamyl-prolyl-tRNA synthetase 2 2
MIRT723279 KRTAP21-2 keratin associated protein 21-2 2 2
MIRT724813 MSX2 msh homeobox 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6509-3p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-6509-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6509-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6509-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6509-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission