pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6737 |
Genomic Coordinates | chr1: 153962351 - 153962420 |
Description | Homo sapiens miR-6737 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6737-5p | |||||||||||||||||||||
Sequence | 6| UUGGGGUGGUCGGCCCUGGAG |26 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Meta-analysis | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ADM | ||||||||||||||||||||
Synonyms | AM, PAMP | ||||||||||||||||||||
Description | adrenomedullin | ||||||||||||||||||||
Transcript | NM_001124 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on ADM | |||||||||||||||||||||
3'UTR of ADM (miRNA target sites are highlighted) |
>ADM|NM_001124|3'UTR 1 GATTTAGGCGCCCATGGTACAAGGAATAGTCGCGCAAGCATCCCGCTGGTGCCTCCCGGGACGAAGGACTTCCCGAGCGG 81 TGTGGGGACCGGGCTCTGACAGCCCTGCGGAGACCCTGAGTCCGGGAGGCACCGTCCGGCGGCGAGCTCTGGCTTTGCAA 161 GGGCCCCTCCTTCTGGGGGCTTCGCTTCCTTAGCCTTGCTCAGGTGCAAGTGCCCCAGGGGGCGGGGTGCAGAAGAATCC 241 GAGTGTTTGCCAGGCTTAAGGAGAGGAGAAACTGAGAAATGAATGCTGAGACCCCCGGAGCAGGGGTCTGAGCCACAGCC 321 GTGCTCGCCCACAAACTGATTTCTCACGGCGTGTCACCCCACCAGGGCGCAAGCCTCACTATTACTTGAACTTTCCAAAA 401 CCTAAAGAGGAAAAGTGCAATGCGTGTTGTACATACAGAGGTAACTATCAATATTTAAGTTTGTTGCTGTCAAGATTTTT 481 TTTGTAACTTCAAATATAGAGATATTTTTGTACGTTATATATTGTATTAAGGGCATTTTAAAAGCAATTATATTGTCCTC 561 CCCTATTTTAAGACGTGAATGTCTCAGCGAGGTGTAAAGTTGTTCGCCGCGTGGAATGTGAGTGTGTTTGTGTGCATGAA 641 AGAGAAAGACTGATTACCTCCTGTGTGGAAGAAGGAAACACCGAGTCTCTGTATAATCTATTTACATAAAATGGGTGATA 721 TGCGAACAGCAAACCAATAAACTGTCTCAATGCTGATTCATAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 133.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000278175.5 | 3UTR | UCACCCCACCAGGGCGCAAGCCUCACUAUUACUUGAACUUUCCAAAACCUAAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714647 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / mildMNase, repB |
Location of target site | ENST00000278175.5 | 3UTR | ACCAGGGCGCAAGCCUCACUAUUACUUGAACUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
67 hsa-miR-6737-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT066215 | MARCH9 | membrane associated ring-CH-type finger 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT074413 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT125300 | MID1IP1 | MID1 interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT153951 | NCOA3 | nuclear receptor coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452776 | FAM136A | family with sequence similarity 136 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT452977 | CABP4 | calcium binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454128 | FOXRED2 | FAD dependent oxidoreductase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455242 | DDX39B | DExD-box helicase 39B | ![]() |
![]() |
2 | 10 | ||||||
MIRT459007 | UQCRH | ubiquinol-cytochrome c reductase hinge protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT459463 | MUC17 | mucin 17, cell surface associated | ![]() |
![]() |
2 | 4 | ||||||
MIRT460871 | UBE2S | ubiquitin conjugating enzyme E2 S | ![]() |
![]() |
2 | 2 | ||||||
MIRT461264 | COX10 | COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT464540 | UBTF | upstream binding transcription factor, RNA polymerase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT465268 | TRIM28 | tripartite motif containing 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465871 | TMEM43 | transmembrane protein 43 | ![]() |
![]() |
2 | 4 | ||||||
MIRT466228 | TMED10 | transmembrane p24 trafficking protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468417 | SETD1B | SET domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT468684 | SEC22C | SEC22 homolog C, vesicle trafficking protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT473399 | MDM4 | MDM4, p53 regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT473517 | MAX | MYC associated factor X | ![]() |
![]() |
2 | 2 | ||||||
MIRT474511 | KLHDC8A | kelch domain containing 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT475801 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT479493 | CDH6 | cadherin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480770 | BMP2 | bone morphogenetic protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481418 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482966 | CSTF2 | cleavage stimulation factor subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483380 | SPATA6 | spermatogenesis associated 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483677 | CYP11A1 | cytochrome P450 family 11 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484328 | EPN1 | epsin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT484963 | UCK1 | uridine-cytidine kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485908 | PGPEP1 | pyroglutamyl-peptidase I | ![]() |
![]() |
2 | 4 | ||||||
MIRT488149 | PRRC2B | proline rich coiled-coil 2B | ![]() |
![]() |
2 | 4 | ||||||
MIRT488943 | CYP2W1 | cytochrome P450 family 2 subfamily W member 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT491835 | ZBTB7A | zinc finger and BTB domain containing 7A | ![]() |
![]() |
2 | 4 | ||||||
MIRT493026 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT499374 | PLCG2 | phospholipase C gamma 2 | ![]() |
![]() |
2 | 11 | ||||||
MIRT499723 | USH1G | USH1 protein network component sans | ![]() |
![]() |
2 | 4 | ||||||
MIRT500349 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT509574 | HIST2H2AB | histone cluster 2 H2A family member b | ![]() |
![]() |
2 | 4 | ||||||
MIRT512794 | GLRX | glutaredoxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT513291 | SETBP1 | SET binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515697 | ZNF321P | zinc finger protein 321, pseudogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT518255 | LEAP2 | liver enriched antimicrobial peptide 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522026 | PAQR3 | progestin and adipoQ receptor family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523169 | HIST3H3 | histone cluster 3 H3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524036 | DNAJC8 | DnaJ heat shock protein family (Hsp40) member C8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533476 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541488 | ADM | adrenomedullin | ![]() |
![]() |
2 | 2 | ||||||
MIRT553987 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT571445 | YKT6 | YKT6 v-SNARE homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT574889 | Plcg2 | phospholipase C, gamma 2 | ![]() |
![]() |
2 | 7 | ||||||
MIRT607544 | GLI2 | GLI family zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607688 | MAPK10 | mitogen-activated protein kinase 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610072 | CRLF1 | cytokine receptor like factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610573 | CACUL1 | CDK2 associated cullin domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614041 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626318 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT634005 | RIF1 | replication timing regulatory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639619 | FGF19 | fibroblast growth factor 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647343 | RPH3AL | rabphilin 3A like (without C2 domains) | ![]() |
![]() |
2 | 2 | ||||||
MIRT689704 | ATXN2 | ataxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691170 | APOL6 | apolipoprotein L6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693165 | NPR1 | natriuretic peptide receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711727 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711806 | ELN | elastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT721546 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT722979 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|