pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1303 |
Genomic Coordinates | chr5: 154685776 - 154685861 |
Synonyms | MIRN1303, hsa-mir-1303, MIR1303 |
Description | Homo sapiens miR-1303 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1303 | ||||||||||||||||||||||||||||||||||||||||||
Sequence | 52| UUUAGAGACGGGGUCUUGCUCU |73 | ||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ZNF485 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | zinc finger protein 485 | ||||||||||||||||||||
Transcript | NM_145312 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on ZNF485 | |||||||||||||||||||||
3'UTR of ZNF485 (miRNA target sites are highlighted) |
>ZNF485|NM_145312|3'UTR 1 TGTGGCAAATTGTGCAGAGTAGTTTATTCCTTCTGACCATCATAGAGGAGACATTAAATAAATTATGCATTTAACAGAAA 81 TACTCTGTACTTCTGAGAGAACACATCACTTGTGAGGATATTCATTGTGAGGTTCTACTAGTGAAATATTTGAAGAAACT 161 AAATGTATGTCAGTATGGAAGTAGTTATAGCATACTGTGTGCTAATTGAAAAGAATGAGGTGGAGCTGTAAATACTGTAC 241 AAAGCCAGGCATGGTGGCATATGCCTGTAGTCCCAGTTACTTGGGAGGCTGAGACAGGATTGCTTAAGCCCAGGAGTTTG 321 AGTCTGTAATGCACTATGATTGTGCATGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCAAGACTCCATCTCTAA 401 GTAAAAAAATACAACAGTAGAAATATACCCATGATAATATACCCAATATACCCTTGTTAAAGAAGCAAGTTTCAGGAAAT 481 CTATATTATATGCATTCAAAAAGACCTGGACAAATAAAGACCAATCTTAACAGCAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 220992.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000361807.3 | 3UTR | UGCAUGUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCAAGACUCCAUCUCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714646 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / mildMNase, repA |
Location of target site | ENST00000361807.3 | 3UTR | GUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCAAGACUCCAUCUCUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
186 hsa-miR-1303 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT035871 | SOAT1 | sterol O-acyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT035872 | FHOD3 | formin homology 2 domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT035873 | RPL7A | ribosomal protein L7a | ![]() |
1 | 1 | |||||||
MIRT035874 | NCAPD2 | non-SMC condensin I complex subunit D2 | ![]() |
1 | 1 | |||||||
MIRT035875 | RPS8 | ribosomal protein S8 | ![]() |
1 | 1 | |||||||
MIRT035876 | AHNAK | AHNAK nucleoprotein | ![]() |
1 | 1 | |||||||
MIRT035877 | ACTB | actin beta | ![]() |
1 | 1 | |||||||
MIRT035878 | DEF8 | differentially expressed in FDCP 8 homolog | ![]() |
1 | 1 | |||||||
MIRT035879 | MET | MET proto-oncogene, receptor tyrosine kinase | ![]() |
1 | 1 | |||||||
MIRT035880 | MED13 | mediator complex subunit 13 | ![]() |
1 | 1 | |||||||
MIRT035881 | FAT3 | FAT atypical cadherin 3 | ![]() |
1 | 1 | |||||||
MIRT035882 | HUWE1 | HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase | ![]() |
1 | 1 | |||||||
MIRT035883 | RPS16 | ribosomal protein S16 | ![]() |
1 | 1 | |||||||
MIRT035884 | CDK6 | cyclin dependent kinase 6 | ![]() |
1 | 1 | |||||||
MIRT035885 | GEMIN5 | gem nuclear organelle associated protein 5 | ![]() |
1 | 1 | |||||||
MIRT035886 | PITRM1 | pitrilysin metallopeptidase 1 | ![]() |
1 | 1 | |||||||
MIRT035887 | PRRC2A | proline rich coiled-coil 2A | ![]() |
1 | 1 | |||||||
MIRT035888 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | ![]() |
1 | 1 | |||||||
MIRT035889 | MLLT6 | MLLT6, PHD finger containing | ![]() |
1 | 1 | |||||||
MIRT035890 | EIF3I | eukaryotic translation initiation factor 3 subunit I | ![]() |
1 | 1 | |||||||
MIRT035891 | FASN | fatty acid synthase | ![]() |
1 | 1 | |||||||
MIRT035892 | LEPREL4 | prolyl 3-hydroxylase family member 4 (non-enzymatic) | ![]() |
1 | 1 | |||||||
MIRT035893 | HSCB | HscB mitochondrial iron-sulfur cluster cochaperone | ![]() |
1 | 1 | |||||||
MIRT035894 | PSME4 | proteasome activator subunit 4 | ![]() |
1 | 1 | |||||||
MIRT035895 | FRS2 | fibroblast growth factor receptor substrate 2 | ![]() |
1 | 1 | |||||||
MIRT035896 | ZNF264 | zinc finger protein 264 | ![]() |
1 | 1 | |||||||
MIRT035897 | HYLS1 | HYLS1, centriolar and ciliogenesis associated | ![]() |
1 | 1 | |||||||
MIRT035898 | USP54 | ubiquitin specific peptidase 54 | ![]() |
1 | 1 | |||||||
MIRT035899 | L1TD1 | LINE1 type transposase domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT035900 | OR51E2 | olfactory receptor family 51 subfamily E member 2 | ![]() |
1 | 1 | |||||||
MIRT053762 | CLDN18 | claudin 18 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT060730 | RPS3 | ribosomal protein S3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT083986 | RAB22A | RAB22A, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT098550 | TBPL1 | TATA-box binding protein like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT134983 | TWF1 | twinfilin actin binding protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT136956 | FNDC3A | fibronectin type III domain containing 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT222065 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT239574 | UBN2 | ubinuclein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT261820 | BUB3 | BUB3, mitotic checkpoint protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT264698 | C11ORF57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 4 | ||||||
MIRT308476 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT377481 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442304 | NEU3 | neuraminidase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446083 | SLC30A10 | solute carrier family 30 member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449606 | PRPF4 | pre-mRNA processing factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453767 | NUCB1 | nucleobindin 1 | ![]() |
![]() |
2 | 10 | ||||||
MIRT455603 | SRSF3 | serine and arginine rich splicing factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455913 | KIF2C | kinesin family member 2C | ![]() |
![]() |
2 | 2 | ||||||
MIRT460091 | ZYG11B | zyg-11 family member B, cell cycle regulator | ![]() |
![]() |
2 | 4 | ||||||
MIRT460866 | UBE2S | ubiquitin conjugating enzyme E2 S | ![]() |
![]() |
2 | 2 | ||||||
MIRT461339 | NUP133 | nucleoporin 133 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463769 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT466368 | THAP1 | THAP domain containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT467168 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468703 | SDHD | succinate dehydrogenase complex subunit D | ![]() |
![]() |
2 | 2 | ||||||
MIRT469122 | RNF126 | ring finger protein 126 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472426 | NCBP2 | nuclear cap binding protein subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT479420 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 8 | ||||||
MIRT484260 | FAM177A1 | family with sequence similarity 177 member A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485468 | IL6ST | interleukin 6 signal transducer | ![]() |
![]() |
2 | 10 | ||||||
MIRT490237 | H2AFZ | H2A histone family member Z | ![]() |
![]() |
2 | 6 | ||||||
MIRT491002 | ATF7IP | activating transcription factor 7 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT492127 | SUMO2 | small ubiquitin-like modifier 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT499169 | RBPJL | recombination signal binding protein for immunoglobulin kappa J region like | ![]() |
![]() |
2 | 2 | ||||||
MIRT499825 | PCSK9 | proprotein convertase subtilisin/kexin type 9 | ![]() |
![]() |
2 | 8 | ||||||
MIRT501794 | NRAS | NRAS proto-oncogene, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT503441 | GINS4 | GINS complex subunit 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT503688 | MAVS | mitochondrial antiviral signaling protein | ![]() |
![]() |
2 | 5 | ||||||
MIRT506926 | IGDCC4 | immunoglobulin superfamily DCC subclass member 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT511430 | HOXA10 | homeobox A10 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512415 | LAYN | layilin | ![]() |
![]() |
2 | 4 | ||||||
MIRT513791 | NIPAL3 | NIPA like domain containing 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516163 | NTMT1 | N-terminal Xaa-Pro-Lys N-methyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516513 | PARK2 | parkin RBR E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT516915 | HINFP | histone H4 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT517102 | NDUFV3 | NADH:ubiquinone oxidoreductase subunit V3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517350 | NLRP9 | NLR family pyrin domain containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518019 | ABHD15 | abhydrolase domain containing 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520945 | SRSF10 | serine and arginine rich splicing factor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525250 | RNF213 | ring finger protein 213 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530634 | PPIC | peptidylprolyl isomerase C | ![]() |
![]() |
2 | 4 | ||||||
MIRT530671 | CHRNB1 | cholinergic receptor nicotinic beta 1 subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT531563 | ILDR1 | immunoglobulin like domain containing receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538205 | CYR61 | cysteine rich angiogenic inducer 61 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538419 | COLEC10 | collectin subfamily member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541964 | ZNF485 | zinc finger protein 485 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543088 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT543257 | ZNF662 | zinc finger protein 662 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543589 | KIAA1549 | KIAA1549 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543955 | RNF20 | ring finger protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544043 | C9orf64 | chromosome 9 open reading frame 64 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548064 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548240 | FBXW7 | F-box and WD repeat domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548442 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT548623 | DAZAP1 | DAZ associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548770 | COLEC12 | collectin subfamily member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549506 | HDDC2 | HD domain containing 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT551924 | AKAP8 | A-kinase anchoring protein 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT555656 | PGRMC1 | progesterone receptor membrane component 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556286 | MAP3K5 | mitogen-activated protein kinase kinase kinase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557012 | HOXD13 | homeobox D13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT563907 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT565527 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT568000 | COMMD2 | COMM domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569831 | PLA2G16 | phospholipase A2 group XVI | ![]() |
![]() |
2 | 4 | ||||||
MIRT573905 | PARP1 | poly(ADP-ribose) polymerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616589 | KLHL9 | kelch like family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617137 | ZNF556 | zinc finger protein 556 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617400 | API5 | apoptosis inhibitor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617455 | CCS | copper chaperone for superoxide dismutase | ![]() |
![]() |
2 | 2 | ||||||
MIRT617799 | ZNF793 | zinc finger protein 793 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618190 | MACC1 | MACC1, MET transcriptional regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT618303 | GNE | glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT618329 | ZNF813 | zinc finger protein 813 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618820 | PHF20 | PHD finger protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619153 | PPDPF | pancreatic progenitor cell differentiation and proliferation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT619530 | ZNF708 | zinc finger protein 708 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619849 | KIR3DX1 | killer cell immunoglobulin like receptor, three Ig domains X1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620806 | SLC26A2 | solute carrier family 26 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621312 | YIPF4 | Yip1 domain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621358 | GUCA1B | guanylate cyclase activator 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT621366 | ART4 | ADP-ribosyltransferase 4 (Dombrock blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT621547 | ZMYM1 | zinc finger MYM-type containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621883 | TAOK1 | TAO kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622451 | RNF19B | ring finger protein 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT623404 | KREMEN1 | kringle containing transmembrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623587 | IPO9 | importin 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623974 | FAM63A | MINDY lysine 48 deubiquitinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624086 | DPP8 | dipeptidyl peptidase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624108 | DNAH10OS | dynein axonemal heavy chain 10 opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT632486 | RNF8 | ring finger protein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634057 | PLIN3 | perilipin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634657 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640682 | MCUR1 | mitochondrial calcium uniporter regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641242 | CENPN | centromere protein N | ![]() |
![]() |
2 | 2 | ||||||
MIRT642260 | ZNF677 | zinc finger protein 677 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642954 | RELA | RELA proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT644326 | IPP | intracisternal A particle-promoted polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT644632 | ICA1L | islet cell autoantigen 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT645721 | POLR3A | RNA polymerase III subunit A | ![]() |
![]() |
2 | 2 | ||||||
MIRT647850 | LYPLA1 | lysophospholipase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT649281 | NEK8 | NIMA related kinase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650038 | VHL | von Hippel-Lindau tumor suppressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT650354 | RRP36 | ribosomal RNA processing 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651144 | ZNF384 | zinc finger protein 384 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651778 | UTP6 | UTP6, small subunit processome component | ![]() |
![]() |
2 | 2 | ||||||
MIRT652576 | TLCD2 | TLC domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654621 | PTPRJ | protein tyrosine phosphatase, receptor type J | ![]() |
![]() |
2 | 2 | ||||||
MIRT656023 | MYO5A | myosin VA | ![]() |
![]() |
2 | 2 | ||||||
MIRT656105 | MSRB3 | methionine sulfoxide reductase B3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657749 | GMEB1 | glucocorticoid modulatory element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657924 | GATSL2 | cytosolic arginine sensor for mTORC1 subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658848 | DUSP19 | dual specificity phosphatase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659100 | DENND6A | DENN domain containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT659153 | DCX | doublecortin | ![]() |
![]() |
2 | 2 | ||||||
MIRT660870 | ADRBK2 | G protein-coupled receptor kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661941 | FAHD1 | fumarylacetoacetate hydrolase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663577 | C10orf32 | BLOC-1 related complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664625 | WDPCP | WD repeat containing planar cell polarity effector | ![]() |
![]() |
2 | 4 | ||||||
MIRT666562 | RHOBTB3 | Rho related BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669992 | GPR156 | G protein-coupled receptor 156 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670445 | RSBN1L | round spermatid basic protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT670853 | IFNAR1 | interferon alpha and beta receptor subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT671942 | SPPL3 | signal peptide peptidase like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674269 | LMOD3 | leiomodin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674424 | MIOX | myo-inositol oxygenase | ![]() |
![]() |
2 | 4 | ||||||
MIRT674982 | ATP5G1 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) | ![]() |
![]() |
2 | 2 | ||||||
MIRT675038 | BACE2 | beta-site APP-cleaving enzyme 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT675309 | C2orf68 | chromosome 2 open reading frame 68 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675641 | TTPAL | alpha tocopherol transfer protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT688688 | CPS1 | carbamoyl-phosphate synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689369 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689605 | AKAP6 | A-kinase anchoring protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691715 | LARS | leucyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT695473 | TRAT1 | T-cell receptor associated transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695530 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695878 | CACNG8 | calcium voltage-gated channel auxiliary subunit gamma 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696586 | ORMDL2 | ORMDL sphingolipid biosynthesis regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703007 | HEATR5A | HEAT repeat containing 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT707942 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709765 | GPR183 | G protein-coupled receptor 183 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710332 | ZNF669 | zinc finger protein 669 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713249 | ZFP30 | ZFP30 zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT716613 | RBM18 | RNA binding motif protein 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT733414 | BAG2 | BCL2 associated athanogene 2 | ![]() |
![]() |
2 | 0 | ||||||
MIRT756135 | THSD7A | thrombospondin type 1 domain containing 7A | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|