pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4640 |
Genomic Coordinates | chr6: 30890883 - 30890972 |
Description | Homo sapiens miR-4640 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4640-5p | ||||||||||||||||||||||||
Sequence | 9| UGGGCCAGGGAGCAGCUGGUGGG |31 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Biomarker Information |
|
---|
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HSPA4L | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | APG-1, HSPH3, Osp94 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | heat shock protein family A (Hsp70) member 4 like | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_014278 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on HSPA4L | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of HSPA4L (miRNA target sites are highlighted) |
>HSPA4L|NM_014278|3'UTR 1 GTCTTAATTTTACCTTCACATTAATTCAAACCGTGCAAGTAACCACGGGGTCCATCTTTTACATCTGGTACACACAACAG 81 ACGCTCAGTTGTTCTTAACCACTTTTGTCATTTGTTTTTTGGAGTAGTTTTGAAAAGTGTTTTATATTGAGTGCACTTCT 161 GTTCATTTCCATTGCTGCTTATATGCAGTGTTAGCCGAATTAGATTTACAAGACAATCTAAGCTTTCCGGATAATTTTAT 241 ATATCAAACATACAGGATGGATACATAGTTGGCAACAGTCTACCTTATTTAAAGCTTCTACTGGGATAAACCTCAATTCC 321 TTTATTCAGGAAAGGATACTTTATTGCATTATTGTTGCAGAAGCATAGATTTAATTGCATCTTTATTTTGAAAAACAAAT 401 GAAAATTGATGGGGTTTAAAGCTACAGAGGCACTGACCTTTTTCTAGTTATTGTATTGCTACAATTTAAATATTAAAACA 481 AATAAGAGCTTTCTCAACAAATTAGTCCATCTCATTGATGTACCACAGAAATCCAAAGCTTTGCTGTCATCACATAAATG 561 AATTAAATCACATGTGAAAGGGAACACACCCAATTTTATGTTAAGGTGAAACCAGCAGTTTGCTTCTTTTATTAGTAATG 641 TGGATTGATGTTTTCTCAGAGTAACTCGTTGTCTTTTCGCTTGAAATTTTTGATCTTGTCCTGAAGACTAGCTGCTGCTA 721 AAACAATGCTAGCCTAAAGATACAGGAGTCTCTGACAAAATGACTTTCATGTTAAGGGGAAATGCTGTTTATCTACTCAG 801 ACATGCATCTGTGATGTTCATAGCCTTGTTTCAGTTATAATAGTTGTCTTGTTTTTTTCTTAATTGATTTTGTTAATAAT 881 ACCTTAACACAGGGTAGGAAGAAGTGGCACAGTGTATTGCATTATATACATTTATCATTGATTTACCTAATGTTACCTTG 961 TAGATTAAACACTATTAAGTGGTAATACTTGAAAAGGAGCACTTATACCATAAGTCTTAGGAAATAATGTTTGTAATAAA 1041 CTTAACTATGTTACATATCAACAGGCAAAAATATAGAATGTTACATAGTGTTGTGTGATTAAATTATAGTTCCTGCTGTT 1121 AACATTACCTTTTGAAACCTTGGCTCCAGTTTTGGTGCTTCTTATACAAATTAAATGCGAAAAGGGACTGTAAACTTAAA 1201 AAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 22824.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714646 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / mildMNase, repA |
Location of target site | ENST00000296464.4 | 3UTR | CCACGCCUGUAAUCCCAGCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
87 hsa-miR-4640-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT100106 | ABT1 | activator of basal transcription 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT248144 | LMBR1L | limb development membrane protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT327062 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT347231 | GATAD2A | GATA zinc finger domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT450221 | CENPN | centromere protein N | ![]() |
![]() |
2 | 2 | ||||||
MIRT451264 | NDUFA11 | NADH:ubiquinone oxidoreductase subunit A11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452701 | C1orf226 | chromosome 1 open reading frame 226 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453212 | CERS1 | ceramide synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454822 | POLR2J3 | RNA polymerase II subunit J3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454883 | RAD50 | RAD50 double strand break repair protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT455783 | TAF8 | TATA-box binding protein associated factor 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455858 | TMEM254 | transmembrane protein 254 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457615 | UPK3BL | uroplakin 3B like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457822 | ITPRIP | inositol 1,4,5-trisphosphate receptor interacting protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT458344 | NOC2L | NOC2 like nucleolar associated transcriptional repressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT458376 | ITM2C | integral membrane protein 2C | ![]() |
![]() |
2 | 2 | ||||||
MIRT458928 | SAMD4B | sterile alpha motif domain containing 4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT459066 | WFIKKN2 | WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460138 | ASB16 | ankyrin repeat and SOCS box containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460818 | FSTL4 | follistatin like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461285 | COX10 | COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT462738 | EFNB1 | ephrin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464556 | UBTF | upstream binding transcription factor, RNA polymerase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT477910 | DUSP2 | dual specificity phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479073 | CNNM4 | cyclin and CBS domain divalent metal cation transport mediator 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT479534 | CDC5L | cell division cycle 5 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT485628 | EEPD1 | endonuclease/exonuclease/phosphatase family domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489896 | PPIC | peptidylprolyl isomerase C | ![]() |
![]() |
2 | 4 | ||||||
MIRT490737 | SRCIN1 | SRC kinase signaling inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491201 | MLLT1 | MLLT1, super elongation complex subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT492681 | PHYHIP | phytanoyl-CoA 2-hydroxylase interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT494593 | ATG7 | autophagy related 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495061 | PADI3 | peptidyl arginine deiminase 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT496623 | TMEM67 | transmembrane protein 67 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497177 | ZBTB40 | zinc finger and BTB domain containing 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498217 | TLN2 | talin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498306 | BCL11B | B-cell CLL/lymphoma 11B | ![]() |
![]() |
2 | 2 | ||||||
MIRT499668 | NPHP3 | nephrocystin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508080 | ANKRD52 | ankyrin repeat domain 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509707 | ANKRD23 | ankyrin repeat domain 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509841 | FOS | Fos proto-oncogene, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT512814 | ARRDC2 | arrestin domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513353 | SLIT1 | slit guidance ligand 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT514293 | FXYD5 | FXYD domain containing ion transport regulator 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516598 | FAM89A | family with sequence similarity 89 member A | ![]() |
![]() |
2 | 4 | ||||||
MIRT516616 | DARS2 | aspartyl-tRNA synthetase 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT518348 | CCL5 | C-C motif chemokine ligand 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520130 | WSB1 | WD repeat and SOCS box containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522072 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526461 | OSBPL5 | oxysterol binding protein like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528278 | MBL2 | mannose binding lectin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534844 | RAB15 | RAB15, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT542245 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT543299 | ZNF585B | zinc finger protein 585B | ![]() |
![]() |
2 | 2 | ||||||
MIRT552456 | ZNF410 | zinc finger protein 410 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553641 | TJAP1 | tight junction associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557103 | HOXA3 | homeobox A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570782 | FANCA | Fanconi anemia complementation group A | ![]() |
![]() |
2 | 2 | ||||||
MIRT630912 | ZMAT2 | zinc finger matrin-type 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631034 | ZNF878 | zinc finger protein 878 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639017 | AAK1 | AP2 associated kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648596 | ZYG11B | zyg-11 family member B, cell cycle regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT648939 | ATP5A1 | ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle | ![]() |
![]() |
2 | 2 | ||||||
MIRT652834 | TACO1 | translational activator of cytochrome c oxidase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT659347 | CSRP1 | cysteine and glycine rich protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664163 | APOBEC3F | apolipoprotein B mRNA editing enzyme catalytic subunit 3F | ![]() |
![]() |
2 | 2 | ||||||
MIRT670511 | ZSCAN22 | zinc finger and SCAN domain containing 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671246 | TMEM41B | transmembrane protein 41B | ![]() |
![]() |
2 | 2 | ||||||
MIRT672120 | ATP6V0A2 | ATPase H+ transporting V0 subunit a2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672313 | CD3D | CD3d molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT672543 | BRMS1L | breast cancer metastasis-suppressor 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT673036 | SGPL1 | sphingosine-1-phosphate lyase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673814 | DARS | aspartyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT674858 | GINM1 | glycoprotein integral membrane 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674970 | SH3BP2 | SH3 domain binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675185 | KIF1C | kinesin family member 1C | ![]() |
![]() |
2 | 2 | ||||||
MIRT675219 | UGDH | UDP-glucose 6-dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT675558 | MED16 | mediator complex subunit 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682566 | EIF4EBP1 | eukaryotic translation initiation factor 4E binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684640 | PDE4C | phosphodiesterase 4C | ![]() |
![]() |
2 | 2 | ||||||
MIRT689722 | ATXN2 | ataxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693594 | SLC39A1 | solute carrier family 39 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704745 | CDKN2B | cyclin dependent kinase inhibitor 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT712779 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718118 | OTOF | otoferlin | ![]() |
![]() |
2 | 2 | ||||||
MIRT720115 | SAMD4A | sterile alpha motif domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT720275 | EIF1AD | eukaryotic translation initiation factor 1A domain containing | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|