pre-miRNA Information
pre-miRNA hsa-mir-4486   
Genomic Coordinates chr11: 19575310 - 19575372
Description Homo sapiens miR-4486 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4486
Sequence 5| GCUGGGCGAGGCUGGCA |21
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs774299284 8 dbSNP
rs902172817 14 dbSNP
rs1222795726 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C3   
Synonyms AHUS5, ARMD9, ASP, C3a, C3b, CPAMD1, HEL-S-62p
Description complement C3
Transcript NM_000064   
Expression
Putative miRNA Targets on C3
3'UTR of C3
(miRNA target sites are highlighted)
>C3|NM_000064|3'UTR
   1 CCACACCCCCATTCCCCCACTCCAGATAAAGCTTCAGTTATATCTCAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' acGGUCGGAGCGGGUcg 5'
            |||  :|| ||||  
Target 5' ccCCA--TTCCCCCAct 3'
7 - 21 99.00 -8.70
2
miRNA  3' acggucggagCG-GGUCg 5'
                    || :||| 
Target 5' tccagataaaGCTTCAGt 3'
21 - 38 72.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30493661 7 COSMIC
COSN30480985 14 COSMIC
COSN30487702 17 COSMIC
COSN30531922 48 COSMIC
COSN30532170 49 COSMIC
COSN28193532 61 COSMIC
COSN26442121 102 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs529117988 2 dbSNP
rs759368543 6 dbSNP
rs751407633 7 dbSNP
rs1157659267 8 dbSNP
rs374414103 9 dbSNP
rs763044103 10 dbSNP
rs1411871899 11 dbSNP
rs1428040767 11 dbSNP
rs1462364473 13 dbSNP
rs1166485735 14 dbSNP
rs943694477 16 dbSNP
rs369677782 17 dbSNP
rs1171555676 18 dbSNP
rs1412185965 19 dbSNP
rs377116496 20 dbSNP
rs371899248 22 dbSNP
rs1479842267 23 dbSNP
rs772285110 25 dbSNP
rs746171602 26 dbSNP
rs779307101 28 dbSNP
rs771420517 31 dbSNP
rs749838591 32 dbSNP
rs1308966716 36 dbSNP
rs1453414586 40 dbSNP
rs751613103 41 dbSNP
rs1222767446 42 dbSNP
rs755597886 46 dbSNP
rs111617932 48 dbSNP
rs113074880 49 dbSNP
rs1209518958 54 dbSNP
rs563213866 55 dbSNP
rs1484278248 74 dbSNP
rs1020127310 85 dbSNP
rs1251475211 89 dbSNP
rs147895142 93 dbSNP
rs11569585 94 dbSNP
rs1366250930 100 dbSNP
rs1236110972 101 dbSNP
rs758259667 103 dbSNP
rs1398184554 108 dbSNP
rs992082211 114 dbSNP
rs1462818599 122 dbSNP
rs1307202089 131 dbSNP
rs563748272 141 dbSNP
rs541279850 147 dbSNP
rs572645448 155 dbSNP
rs11569566 161 dbSNP
rs931663537 165 dbSNP
rs898905154 166 dbSNP
rs1037492810 179 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 718.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acggucggAGCGGGUCg 5'
                  |||||||| 
Target 5' uuguucugUCGCCCAGg 3'
8 - 24
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acggucggAGCGGGUCg 5'
                  |||||||| 
Target 5' --------UCGCCCAGg 3'
1 - 9
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760631. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_B ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000245907.6 | 3UTR | UCGCCCAGGCUGGAGUGCAGUGGCACAAUCUCGGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000245907.6 | 3UTR | CAGAGUCUUGUUCUGUCGCCCAGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-4486 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT254654 NF2 neurofibromin 2 2 2
MIRT458684 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT470845 PLXND1 plexin D1 2 2
MIRT493011 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT497264 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497675 SYNGR1 synaptogyrin 1 2 2
MIRT498219 TLN2 talin 2 2 2
MIRT498310 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504048 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT519959 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT531521 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT533144 WNT10A Wnt family member 10A 2 2
MIRT533541 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533681 TMEM86A transmembrane protein 86A 2 2
MIRT540321 PIGR polymeric immunoglobulin receptor 2 2
MIRT540719 GUF1 GUF1 homolog, GTPase 2 2
MIRT541566 ZNF43 zinc finger protein 43 2 4
MIRT541787 TBCCD1 TBCC domain containing 1 2 2
MIRT541925 ORC1 origin recognition complex subunit 1 2 4
MIRT542232 FUT9 fucosyltransferase 9 2 2
MIRT542285 POLR3K RNA polymerase III subunit K 2 2
MIRT542299 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 2 4
MIRT542368 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542441 C3 complement C3 2 4
MIRT542475 APOC3 apolipoprotein C3 2 2
MIRT542535 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT542640 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT542788 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT552104 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT564913 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568606 ACVR2A activin A receptor type 2A 2 2
MIRT607389 LANCL3 LanC like 3 2 2
MIRT607451 ZNF543 zinc finger protein 543 2 2
MIRT610058 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610793 KLK2 kallikrein related peptidase 2 2 2
MIRT617176 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT620579 WBSCR27 methyltransferase like 27 2 4
MIRT622085 SRPX2 sushi repeat containing protein, X-linked 2 2 2
MIRT622542 PXMP4 peroxisomal membrane protein 4 2 2
MIRT630009 PDE6B phosphodiesterase 6B 2 2
MIRT631813 PTDSS2 phosphatidylserine synthase 2 2 2
MIRT632721 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT632757 MED28 mediator complex subunit 28 2 2
MIRT634821 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT635255 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT637082 SELPLG selectin P ligand 2 2
MIRT637357 ZNF460 zinc finger protein 460 2 2
MIRT637472 DEFB105B defensin beta 105B 2 4
MIRT637504 DEFB105A defensin beta 105A 2 4
MIRT639022 AAK1 AP2 associated kinase 1 2 2
MIRT641012 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT642170 HEBP2 heme binding protein 2 2 2
MIRT648977 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT650515 UFM1 ubiquitin fold modifier 1 2 2
MIRT650949 INMT indolethylamine N-methyltransferase 2 2
MIRT658354 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT660736 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT662191 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT663045 SLC16A4 solute carrier family 16 member 4 2 2
MIRT664811 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT665161 SF3A1 splicing factor 3a subunit 1 2 4
MIRT665346 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 2
MIRT666493 SBNO1 strawberry notch homolog 1 2 2
MIRT666545 RNF115 ring finger protein 115 2 2
MIRT669351 BMP3 bone morphogenetic protein 3 2 2
MIRT669904 KIAA0754 KIAA0754 2 4
MIRT670323 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT670430 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT670672 KIAA1551 KIAA1551 2 2
MIRT670746 HOOK3 hook microtubule tethering protein 3 2 2
MIRT670998 PTGIS prostaglandin I2 synthase 2 2
MIRT671290 RPL37A ribosomal protein L37a 2 2
MIRT671469 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT671833 STIL STIL, centriolar assembly protein 2 2
MIRT673006 TAF1 TATA-box binding protein associated factor 1 2 2
MIRT675881 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT678625 OLFML2A olfactomedin like 2A 2 2
MIRT678790 NUPL2 nucleoporin like 2 2 2
MIRT679560 LIN9 lin-9 DREAM MuvB core complex component 2 2
MIRT681032 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682480 LIX1L limb and CNS expressed 1 like 2 2
MIRT682758 MDM2 MDM2 proto-oncogene 2 2
MIRT682810 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT682867 C9orf156 tRNA methyltransferase O 2 2
MIRT689233 RPS19 ribosomal protein S19 2 2
MIRT689305 C5AR2 complement component 5a receptor 2 2 2
MIRT689363 ZNF101 zinc finger protein 101 2 2
MIRT689629 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT689654 RBM23 RNA binding motif protein 23 2 2
MIRT690148 PPIL6 peptidylprolyl isomerase like 6 2 2
MIRT691407 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT691847 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT692234 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT694320 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT694365 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT696215 LYZ lysozyme 2 2
MIRT697230 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT700487 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT700612 PRKCA protein kinase C alpha 2 2
MIRT702456 KIAA1467 family with sequence similarity 234 member B 2 2
MIRT702990 HERPUD2 HERPUD family member 2 2 2
MIRT703998 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT704701 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT712481 FSTL3 follistatin like 3 2 2
MIRT712781 ZNF154 zinc finger protein 154 2 2
MIRT714369 HP1BP3 heterochromatin protein 1 binding protein 3 2 2
MIRT722570 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722839 C17orf102 chromosome 17 open reading frame 102 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4486 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4486 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4486 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (SGC-7901)
hsa-mir-4486 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4486 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4486 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission