pre-miRNA Information
pre-miRNA hsa-mir-873   
Genomic Coordinates chr9: 28888879 - 28888955
Synonyms MIRN873, hsa-mir-873, MIR873
Description Homo sapiens miR-873 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-873-3p
Sequence 46| GGAGACUGAUGAGUUCCCGGGA |67
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760528397 3 dbSNP
rs773403294 9 dbSNP
rs1273846238 13 dbSNP
rs1339396073 15 dbSNP
rs1247999695 18 dbSNP
rs377380148 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AKR7A2   
Synonyms AFAR, AFAR1, AFB1-AR1, AKR7
Description aldo-keto reductase family 7 member A2
Transcript NM_003689   
Expression
Putative miRNA Targets on AKR7A2
3'UTR of AKR7A2
(miRNA target sites are highlighted)
>AKR7A2|NM_003689|3'UTR
   1 GCCCATCATGGCTCAGGCTGCCCAAGGCTTTTCTGTCACCTCTTTTGTTCTCTCACACTGACCAGTCTTGGCCTTAAGCT
  81 GACTTAGAAGGGTTTTTCTGAATTGTCTAGATCCATGCATTATTTTTCTAGCTTCCTGCCTTGCTCCCTATTCACTTTAC
 161 ACTGTGAAAGGTGGGGGGTGAGTCCCACTTGAGCGCTTCCTGTTGAATAAAGCAGGCACTTGACCTGGCTGTAGCCTAGG
 241 TCTTGAGTGAACCCCAAAAACTTGCTTTCTCTGCTGTTAACACTTTGTTTCCCATCCTACCTGGGGACTGAGAAAGGGCA
 321 GAACCATGGGCTGGAGTCTTCAGAGGGCAGAGGTAGTAGGAGGGTCACAGAAGCACACTGCCCTCCCAGGGTCTCCTCGG
 401 GCCCCTGGTCTGAATACCCACCTGACCTCTCAACATTGAGGTGTCTCTCACTCTTCTACACACGATAGAAAAGAGAGTCA
 481 TACACCTGCAGTACATTTTCTCTAATTCAGAGTTGCCTCAATACATTCTTAGGAATGAAACAACTGGGACAAAGAAACTA
 561 CCATTAGAGTCACTACCAAGAAGAAGAACACTTCCCAGGATCTGTGGAACATCTTGAAGCTCTCAATCTTAGCCTCCTCT
 641 TGTCTTAACTAAAGCCTCTTGTCTTTTCACCCATTAGGTTCTCAGTCTTGGCTCTGGGCCTCCTGTTCGGCATGGGGACA
 721 GACATAGGCAGCCAAGGTCCTCATTTCCCTTGGAAACCCCTACTCCAAACAGGAGGCACCAAGGCTGAGAATAAGAATCC
 801 TTGGTTCAGTGGTTGCTGAACCTGCTGCATTCCCAGTGCACCAAAATCCCTCCAGCCATGGGCAGGGCAGCAGGCAGCAC
 881 TTGGAGCAGCTTCTTGAAGCAATGAAAGAGGCCCAACCTGGAAATTTACTTTTTCATTTATATTTATTATTTGTTCTTGA
 961 GACAGGCTCTTGCTCTGTCACCTAGACCGGAGTACAGTGGCATGATCACTGCTCACAGCAATTTTGACCTCCGGGGCTCA
1041 AGGGATCCTCCCACCTCAGCCTCCCGAGAAGTTTTTATTTTTATTTTTTTTGTGGAGTGGAGATCTCCCTATGTTGTCAC
1121 CGTCTTTTCTGTTTACCCGTAACAAAACAGATGCTCACCCATGTGGAATGGTGTATCAGTTATCTTTGCACAACAAACCA
1201 CACTAATAAGTTGCTTGAAAAGATAAAATCCAAGGCTGGCACAGTGGCTCATGGCTATAATCCCAGCACGTTGAGAGCCC
1281 AAAGCAGGCAGATCACTTGAGCTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAACCCTGTCTCTACCAAAAATAC
1361 AAAAAATTAATCTGTGTGTGGTGGCACATACCTGTGGTCCCAGCTACTCTGGAGGCTGAGGTGGGAGGATCGCCTGGGCC
1441 CCGGAAACAGAGGTTGCAGTGGGCCGAGATCATGCCATTACACTCTAGCCTGGGTGACACAGTCAGACCCCATCTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agggcccuUGAGUAGUCAGAGg 5'
                  ||| | ||||||: 
Target 5' tctctcacACTGACCAGTCTTg 3'
49 - 70 138.00 -11.70
2
miRNA  3' agGGCCCUUGAGUAGUCAGAGg 5'
            ||   |: |: |||||||: 
Target 5' acCCATTAGGTTCTCAGTCTTg 3'
669 - 690 136.00 -16.50
3
miRNA  3' agggCCCU-UGA--GU--AGUCAGAGg 5'
              ||||  ||  ||  |||| ||| 
Target 5' tcaaGGGATCCTCCCACCTCAGCCTCc 3'
1038 - 1064 122.00 -19.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26600205 22 COSMIC
COSN26668934 30 COSMIC
COSN26669472 37 COSMIC
COSN30158800 58 COSMIC
COSN31494561 59 COSMIC
COSN31541214 62 COSMIC
COSN30482073 70 COSMIC
COSN30126607 92 COSMIC
COSN31570841 124 COSMIC
COSN26141429 190 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs2231207 5 dbSNP
rs776281812 6 dbSNP
rs566024349 7 dbSNP
rs760217273 8 dbSNP
rs775120933 9 dbSNP
rs370973368 10 dbSNP
rs568320742 12 dbSNP
rs549804370 13 dbSNP
rs773645985 14 dbSNP
rs1424664219 15 dbSNP
rs770133827 16 dbSNP
rs1487223540 17 dbSNP
rs1182415852 19 dbSNP
rs748463371 23 dbSNP
rs781432553 24 dbSNP
rs1036568477 25 dbSNP
rs1482863556 33 dbSNP
rs755213636 35 dbSNP
rs747278746 37 dbSNP
rs377725828 39 dbSNP
rs758539183 42 dbSNP
rs113185651 47 dbSNP
rs751228167 47 dbSNP
rs765968829 50 dbSNP
rs933272695 50 dbSNP
rs1199809895 58 dbSNP
rs908317330 65 dbSNP
rs984297091 72 dbSNP
rs773019911 75 dbSNP
rs1195460399 79 dbSNP
rs1357245889 83 dbSNP
rs1317258494 86 dbSNP
rs1201441569 91 dbSNP
rs1382106307 103 dbSNP
rs1264296586 112 dbSNP
rs1444259303 115 dbSNP
rs952384467 115 dbSNP
rs564042097 119 dbSNP
rs1327884206 122 dbSNP
rs1405611651 125 dbSNP
rs542998578 135 dbSNP
rs897733171 153 dbSNP
rs1036655306 158 dbSNP
rs1380355970 163 dbSNP
rs552231565 170 dbSNP
rs1471412845 171 dbSNP
rs145371999 173 dbSNP
rs909863111 178 dbSNP
rs1294295555 179 dbSNP
rs1221257954 180 dbSNP
rs193206961 193 dbSNP
rs79655192 194 dbSNP
rs114203596 195 dbSNP
rs111259968 199 dbSNP
rs187617169 205 dbSNP
rs1347149272 228 dbSNP
rs967414865 240 dbSNP
rs960604449 242 dbSNP
rs1360628647 243 dbSNP
rs1160573461 253 dbSNP
rs1031923518 256 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8574.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agggcccuugaguagUCAGAGg 5'
                         |||||| 
Target 5' ------------cagAGUCUCa 3'
1 - 10
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agggcccuugaguagUCAGAGg 5'
                         |||||| 
Target 5' ------------cagAGUCUCa 3'
1 - 10
Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000235835.3 | 3UTR | CAGAGUCUCACUUUGUUGCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-873-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081178 MIDN midnolin 2 4
MIRT109809 ZFX zinc finger protein, X-linked 2 4
MIRT242383 TMC5 transmembrane channel like 5 2 4
MIRT444003 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444097 SEPHS1 selenophosphate synthetase 1 2 2
MIRT446158 RPL12 ribosomal protein L12 2 2
MIRT446859 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT447275 FZD5 frizzled class receptor 5 2 2
MIRT447391 TMPRSS15 transmembrane protease, serine 15 2 2
MIRT448817 FKBP1A FK506 binding protein 1A 2 4
MIRT450582 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT451776 USP36 ubiquitin specific peptidase 36 2 2
MIRT457961 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT458424 KLHL38 kelch like family member 38 2 4
MIRT461383 SLFN12L schlafen family member 12 like 2 2
MIRT467793 SLC2A14 solute carrier family 2 member 14 2 2
MIRT476517 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT480290 C7orf73 short transmembrane mitochondrial protein 1 2 4
MIRT482745 HES7 hes family bHLH transcription factor 7 2 10
MIRT483189 HIST1H2AH histone cluster 1 H2A family member h 2 6
MIRT486545 DCTN4 dynactin subunit 4 2 2
MIRT486581 ZNF619 zinc finger protein 619 2 2
MIRT492604 POLR3E RNA polymerase III subunit E 2 2
MIRT494130 DCAF7 DDB1 and CUL4 associated factor 7 2 6
MIRT496023 ZBED3 zinc finger BED-type containing 3 2 2
MIRT497121 NBEAL1 neurobeachin like 1 2 2
MIRT497400 TMEM245 transmembrane protein 245 2 2
MIRT501410 RANBP10 RAN binding protein 10 2 2
MIRT510947 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT512494 ARID2 AT-rich interaction domain 2 2 2
MIRT512595 ZNF783 zinc finger family member 783 2 2
MIRT512612 CNTN4 contactin 4 2 2
MIRT517808 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT520686 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT526179 HEPH hephaestin 2 2
MIRT532568 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT533979 TADA2A transcriptional adaptor 2A 2 2
MIRT538622 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539703 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539806 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT540422 FAM83F family with sequence similarity 83 member F 2 2
MIRT540506 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540619 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT542423 ZNF331 zinc finger protein 331 2 2
MIRT542454 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT543383 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT544777 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT544923 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 2
MIRT549768 ZNF611 zinc finger protein 611 2 4
MIRT551242 COLEC10 collectin subfamily member 10 2 2
MIRT560474 ENSA endosulfine alpha 2 2
MIRT569738 GPR173 G protein-coupled receptor 173 2 2
MIRT571297 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT572345 CKAP2L cytoskeleton associated protein 2 like 2 2
MIRT573112 ERBB2IP erbb2 interacting protein 2 2
MIRT607744 ANGPT4 angiopoietin 4 2 2
MIRT607903 SPRYD4 SPRY domain containing 4 2 2
MIRT611744 SERPING1 serpin family G member 1 2 4
MIRT615101 BNC2 basonuclin 2 2 2
MIRT619124 CD40LG CD40 ligand 2 2
MIRT625572 ANKRD42 ankyrin repeat domain 42 2 2
MIRT629038 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT633986 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635675 COX18 COX18, cytochrome c oxidase assembly factor 2 4
MIRT637471 DEFB105B defensin beta 105B 2 4
MIRT637503 DEFB105A defensin beta 105A 2 4
MIRT639735 MAP2K2 mitogen-activated protein kinase kinase 2 2 2
MIRT640730 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT645364 C9orf47 chromosome 9 open reading frame 47 2 2
MIRT647938 RNF152 ring finger protein 152 2 2
MIRT649400 SH2D4A SH2 domain containing 4A 2 2
MIRT656860 KIN Kin17 DNA and RNA binding protein 2 2
MIRT663470 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT663507 NKAPL NFKB activating protein like 2 4
MIRT667690 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT677403 PCNP PEST proteolytic signal containing nuclear protein 2 2
MIRT678682 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT678789 NUPL2 nucleoporin like 2 2 2
MIRT680649 KIAA1456 KIAA1456 2 2
MIRT682450 MTX3 metaxin 3 2 2
MIRT682740 CA6 carbonic anhydrase 6 2 2
MIRT684421 TUFT1 tuftelin 1 2 2
MIRT690535 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT690595 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690771 PLA2G2C phospholipase A2 group IIC 2 2
MIRT692233 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT693667 MXRA7 matrix remodeling associated 7 2 2
MIRT695551 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT695870 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT696214 LYZ lysozyme 2 2
MIRT698368 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT700795 PHTF2 putative homeodomain transcription factor 2 2 2
MIRT701640 MYLK3 myosin light chain kinase 3 2 2
MIRT702989 HERPUD2 HERPUD family member 2 2 2
MIRT703627 FBXL3 F-box and leucine rich repeat protein 3 2 2
MIRT703783 FAM102B family with sequence similarity 102 member B 2 2
MIRT704293 DDX19B DEAD-box helicase 19B 2 2
MIRT704828 CDC73 cell division cycle 73 2 2
MIRT705014 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT708480 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT710770 PHF7 PHD finger protein 7 2 2
MIRT718918 TRIM66 tripartite motif containing 66 2 2
MIRT720390 ZNF549 zinc finger protein 549 2 2
MIRT720593 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT723515 SIGLEC8 sialic acid binding Ig like lectin 8 2 2
MIRT724458 PRKX protein kinase, X-linked 2 2
MIRT737267 UMAD1 UBAP1-MVB12-associated (UMA) domain containing 1 3 0
MIRT737356 ZIC2 Zic family member 2 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-873 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-873 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-873 Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-873 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-873-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-873-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission