miRTarBase - #MIRT542456


—
pre-miRNA Information
pre-miRNA hsa-mir-3120   
Genomic Coordinates chr1: 172138808 - 172138888
Description Homo sapiens miR-3120 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3120-5p
Sequence 13| CCUGUCUGUGCCUGCUGUACA |33
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 19 1 + 172138838 26449202, 27587585 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN26637643 8 COSMIC
COSN31603497 11 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs750386761 8 dbSNP
rs760725207 9 dbSNP
rs766486759 10 dbSNP
rs754055278 12 dbSNP
rs755288536 19 dbSNP
rs754726014 21 dbSNP
Putative Targets

Gene Information
Gene Symbol AKR7A2   
Synonyms AFAR, AFAR1, AFB1-AR1, AKR7
Description aldo-keto reductase family 7 member A2
Transcript NM_003689   
Expression
Putative miRNA Targets on AKR7A2
3'UTR of AKR7A2
(miRNA target sites are highlighted)		 
>AKR7A2|NM_003689|3'UTR
   1 GCCCATCATGGCTCAGGCTGCCCAAGGCTTTTCTGTCACCTCTTTTGTTCTCTCACACTGACCAGTCTTGGCCTTAAGCT
  81 GACTTAGAAGGGTTTTTCTGAATTGTCTAGATCCATGCATTATTTTTCTAGCTTCCTGCCTTGCTCCCTATTCACTTTAC
 161 ACTGTGAAAGGTGGGGGGTGAGTCCCACTTGAGCGCTTCCTGTTGAATAAAGCAGGCACTTGACCTGGCTGTAGCCTAGG
 241 TCTTGAGTGAACCCCAAAAACTTGCTTTCTCTGCTGTTAACACTTTGTTTCCCATCCTACCTGGGGACTGAGAAAGGGCA
 321 GAACCATGGGCTGGAGTCTTCAGAGGGCAGAGGTAGTAGGAGGGTCACAGAAGCACACTGCCCTCCCAGGGTCTCCTCGG
 401 GCCCCTGGTCTGAATACCCACCTGACCTCTCAACATTGAGGTGTCTCTCACTCTTCTACACACGATAGAAAAGAGAGTCA
 481 TACACCTGCAGTACATTTTCTCTAATTCAGAGTTGCCTCAATACATTCTTAGGAATGAAACAACTGGGACAAAGAAACTA
 561 CCATTAGAGTCACTACCAAGAAGAAGAACACTTCCCAGGATCTGTGGAACATCTTGAAGCTCTCAATCTTAGCCTCCTCT
 641 TGTCTTAACTAAAGCCTCTTGTCTTTTCACCCATTAGGTTCTCAGTCTTGGCTCTGGGCCTCCTGTTCGGCATGGGGACA
 721 GACATAGGCAGCCAAGGTCCTCATTTCCCTTGGAAACCCCTACTCCAAACAGGAGGCACCAAGGCTGAGAATAAGAATCC
 801 TTGGTTCAGTGGTTGCTGAACCTGCTGCATTCCCAGTGCACCAAAATCCCTCCAGCCATGGGCAGGGCAGCAGGCAGCAC
 881 TTGGAGCAGCTTCTTGAAGCAATGAAAGAGGCCCAACCTGGAAATTTACTTTTTCATTTATATTTATTATTTGTTCTTGA
 961 GACAGGCTCTTGCTCTGTCACCTAGACCGGAGTACAGTGGCATGATCACTGCTCACAGCAATTTTGACCTCCGGGGCTCA
1041 AGGGATCCTCCCACCTCAGCCTCCCGAGAAGTTTTTATTTTTATTTTTTTTGTGGAGTGGAGATCTCCCTATGTTGTCAC
1121 CGTCTTTTCTGTTTACCCGTAACAAAACAGATGCTCACCCATGTGGAATGGTGTATCAGTTATCTTTGCACAACAAACCA
1201 CACTAATAAGTTGCTTGAAAAGATAAAATCCAAGGCTGGCACAGTGGCTCATGGCTATAATCCCAGCACGTTGAGAGCCC
1281 AAAGCAGGCAGATCACTTGAGCTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAACCCTGTCTCTACCAAAAATAC
1361 AAAAAATTAATCTGTGTGTGGTGGCACATACCTGTGGTCCCAGCTACTCTGGAGGCTGAGGTGGGAGGATCGCCTGGGCC
1441 CCGGAAACAGAGGTTGCAGTGGGCCGAGATCATGCCATTACACTCTAGCCTGGGTGACACAGTCAGACCCCATCTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acAUGUCGU--CCGUGUCUGUcc 5'
            | |:|||  || |||||||  
Target 5' tgTTCGGCATGGGGACAGACAta 3'
 704 - 726 145.00 -18.80
2 
miRNA  3' acaugUCGU-CCGU-GUCUGUCc 5'
               :||| |||| |||:||| 
Target 5' ccatgGGCAGGGCAGCAGGCAGc 3'
 856 - 878 144.00 -18.60
3 
miRNA  3' acaUGUCGUCCGU-GUCUGUCc 5'
             | |||    | |||:||| 
Target 5' ttgAGAGCCCAAAGCAGGCAGa 3'
 1271 - 1292 126.00 -12.62
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26600205 22 COSMIC
COSN26668934 30 COSMIC
COSN26669472 37 COSMIC
COSN30158800 58 COSMIC
COSN31494561 59 COSMIC
COSN31541214 62 COSMIC
COSN30482073 70 COSMIC
COSN30126607 92 COSMIC
COSN31570841 124 COSMIC
COSN26141429 190 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs2231207 5 dbSNP
rs776281812 6 dbSNP
rs566024349 7 dbSNP
rs760217273 8 dbSNP
rs775120933 9 dbSNP
rs370973368 10 dbSNP
rs568320742 12 dbSNP
rs549804370 13 dbSNP
rs773645985 14 dbSNP
rs1424664219 15 dbSNP
rs770133827 16 dbSNP
rs1487223540 17 dbSNP
rs1182415852 19 dbSNP
rs748463371 23 dbSNP
rs781432553 24 dbSNP
rs1036568477 25 dbSNP
rs1482863556 33 dbSNP
rs755213636 35 dbSNP
rs747278746 37 dbSNP
rs377725828 39 dbSNP
rs758539183 42 dbSNP
rs113185651 47 dbSNP
rs751228167 47 dbSNP
rs765968829 50 dbSNP
rs933272695 50 dbSNP
rs1199809895 58 dbSNP
rs908317330 65 dbSNP
rs984297091 72 dbSNP
rs773019911 75 dbSNP
rs1195460399 79 dbSNP
rs1357245889 83 dbSNP
rs1317258494 86 dbSNP
rs1201441569 91 dbSNP
rs1382106307 103 dbSNP
rs1264296586 112 dbSNP
rs1444259303 115 dbSNP
rs952384467 115 dbSNP
rs564042097 119 dbSNP
rs1327884206 122 dbSNP
rs1405611651 125 dbSNP
rs542998578 135 dbSNP
rs897733171 153 dbSNP
rs1036655306 158 dbSNP
rs1380355970 163 dbSNP
rs552231565 170 dbSNP
rs1471412845 171 dbSNP
rs145371999 173 dbSNP
rs909863111 178 dbSNP
rs1294295555 179 dbSNP
rs1221257954 180 dbSNP
rs193206961 193 dbSNP
rs79655192 194 dbSNP
rs114203596 195 dbSNP
rs111259968 199 dbSNP
rs187617169 205 dbSNP
rs1347149272 228 dbSNP
rs967414865 240 dbSNP
rs960604449 242 dbSNP
rs1360628647 243 dbSNP
rs1160573461 253 dbSNP
rs1031923518 256 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8574.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000235835.3 | 3UTR | CAGAGUCUCACUUUGUUGCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
134 hsa-miR-3120-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT096972 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT442624 LOX lysyl oxidase 2 2
MIRT473438 MDM4 MDM4, p53 regulator 2 2
MIRT490011 KIFC2 kinesin family member C2 2 2
MIRT496449 N6AMT1 N-6 adenine-specific DNA methyltransferase 1 2 2
MIRT496752 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT497721 CYP1A1 cytochrome P450 family 1 subfamily A member 1 2 2
MIRT498287 PADI3 peptidyl arginine deiminase 3 2 2
MIRT503195 ACVR1B activin A receptor type 1B 2 4
MIRT504760 TEP1 telomerase associated protein 1 2 4
MIRT517810 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT519686 ZNF622 zinc finger protein 622 2 4
MIRT520263 URGCP upregulator of cell proliferation 2 2
MIRT523051 ICMT isoprenylcysteine carboxyl methyltransferase 2 2
MIRT525601 OLR1 oxidized low density lipoprotein receptor 1 2 4
MIRT526995 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT528699 TRAF3IP2 TRAF3 interacting protein 2 2 4
MIRT533142 WNT10A Wnt family member 10A 2 2
MIRT537618 ERI1 exoribonuclease 1 2 2
MIRT539707 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539752 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT539808 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT539941 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT540424 FAM83F family with sequence similarity 83 member F 2 2
MIRT540509 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540720 GUF1 GUF1 homolog, GTPase 2 2
MIRT541630 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT542286 POLR3K RNA polymerase III subunit K 2 2
MIRT542456 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT542550 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT542771 PPAP2B phospholipid phosphatase 3 2 2
MIRT550085 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT551458 CARKD NAD(P)HX dehydratase 2 2
MIRT555622 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT569136 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT572328 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT574607 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT575583 Mcm8 minichromosome maintenance 8 homologous recombination repair factor 2 4
MIRT576125 Hrk harakiri, BCL2 interacting protein (contains only BH3 domain) 2 5
MIRT576657 Fam216a family with sequence similarity 216, member A 2 2
MIRT607222 ACSM2A acyl-CoA synthetase medium chain family member 2A 2 4
MIRT607292 CD300E CD300e molecule 2 6
MIRT607746 ANGPT4 angiopoietin 4 2 2
MIRT607905 SPRYD4 SPRY domain containing 4 2 2
MIRT608159 HRK harakiri, BCL2 interacting protein 2 7
MIRT608657 ABCF3 ATP binding cassette subfamily F member 3 2 4
MIRT609115 ZNF703 zinc finger protein 703 2 6
MIRT610231 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT610870 NUDCD3 NudC domain containing 3 2 2
MIRT611217 MC2R melanocortin 2 receptor 2 2
MIRT614858 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT616966 LMX1A LIM homeobox transcription factor 1 alpha 2 2
MIRT617258 GLIPR1L2 GLI pathogenesis related 1 like 2 2 2
MIRT618009 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT619067 BSND barttin CLCNK type accessory beta subunit 2 4
MIRT619295 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT619348 GINM1 glycoprotein integral membrane 1 2 2
MIRT619362 CFHR5 complement factor H related 5 2 2
MIRT619541 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT619782 NRIP2 nuclear receptor interacting protein 2 2 2
MIRT619994 NPAP1 nuclear pore associated protein 1 2 2
MIRT621030 CDC14B cell division cycle 14B 2 2
MIRT622033 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT622728 PITPNM3 PITPNM family member 3 2 2
MIRT623144 NAV2 neuron navigator 2 2 2
MIRT623600 IPO9 importin 9 2 2
MIRT624608 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT624905 CTCFL CCCTC-binding factor like 2 2
MIRT625030 SPC24 SPC24, NDC80 kinetochore complex component 2 2
MIRT625688 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 5
MIRT626531 EMCN endomucin 2 2
MIRT627204 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT628033 LSAMP limbic system-associated membrane protein 2 2
MIRT628203 FREM2 FRAS1 related extracellular matrix protein 2 2 2
MIRT631012 LINS lines homolog 1 2 2
MIRT633195 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT633890 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT634023 MOB4 MOB family member 4, phocein 2 2
MIRT634416 PLCXD3 phosphatidylinositol specific phospholipase C X domain containing 3 2 2
MIRT636866 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT642527 ANKRD9 ankyrin repeat domain 9 2 2
MIRT645408 FAM110A family with sequence similarity 110 member A 2 2
MIRT645635 SYTL4 synaptotagmin like 4 2 2
MIRT646013 TNFAIP8L2 TNF alpha induced protein 8 like 2 2 2
MIRT646686 ASGR2 asialoglycoprotein receptor 2 2 2
MIRT652838 TACO1 translational activator of cytochrome c oxidase I 2 2
MIRT655156 PHF21B PHD finger protein 21B 2 2
MIRT658491 EXOC7 exocyst complex component 7 2 2
MIRT659398 CORO2A coronin 2A 2 2
MIRT666825 PRCP prolylcarboxypeptidase 2 2
MIRT666866 POU2F2 POU class 2 homeobox 2 2 2
MIRT668224 GABRA1 gamma-aminobutyric acid type A receptor alpha1 subunit 2 2
MIRT673288 PDE3A phosphodiesterase 3A 2 2
MIRT673878 KLF2 Kruppel like factor 2 2 2
MIRT681721 KCNE4 potassium voltage-gated channel subfamily E regulatory subunit 4 2 2
MIRT682406 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT684109 MCM10 minichromosome maintenance 10 replication initiation factor 2 2
MIRT684423 TUFT1 tuftelin 1 2 2
MIRT684684 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT686638 TMEM184C transmembrane protein 184C 2 2
MIRT689457 NXN nucleoredoxin 2 2
MIRT689627 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT690773 PLA2G2C phospholipase A2 group IIC 2 2
MIRT690822 SGSM2 small G protein signaling modulator 2 2 2
MIRT693669 MXRA7 matrix remodeling associated 7 2 2
MIRT695553 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT695872 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT698160 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT699933 RUFY2 RUN and FYVE domain containing 2 2 2
MIRT708639 UBE2W ubiquitin conjugating enzyme E2 W 2 2
MIRT710816 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT711242 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT711542 MSH3 mutS homolog 3 2 2
MIRT711749 DTX1 deltex E3 ubiquitin ligase 1 2 2
MIRT712303 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT712922 RPF2 ribosome production factor 2 homolog 2 2
MIRT714027 SYDE2 synapse defective Rho GTPase homolog 2 2 2
MIRT714768 TERF1 telomeric repeat binding factor 1 2 2
MIRT714844 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif 17 2 2
MIRT715223 NPVF neuropeptide VF precursor 2 2
MIRT716110 GMPS guanine monophosphate synthase 2 2
MIRT716174 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT716383 C6orf223 chromosome 6 open reading frame 223 2 2
MIRT716527 KSR2 kinase suppressor of ras 2 2 2
MIRT716962 P2RY6 pyrimidinergic receptor P2Y6 2 2
MIRT717605 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT717696 PTGS1 prostaglandin-endoperoxide synthase 1 2 2
MIRT721360 ENTHD1 ENTH domain containing 1 2 2
MIRT721381 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT721935 RASSF2 Ras association domain family member 2 2 2
MIRT722094 SUSD1 sushi domain containing 1 2 2
MIRT722837 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT722990 TOR1A torsin family 1 member A 2 2
MIRT724174 ABCF2 ATP binding cassette subfamily F member 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3120-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-3120-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-3120-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission