pre-miRNA Information
pre-miRNA hsa-mir-4486   
Genomic Coordinates chr11: 19575310 - 19575372
Description Homo sapiens miR-4486 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4486
Sequence 5| GCUGGGCGAGGCUGGCA |21
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs774299284 8 dbSNP
rs902172817 14 dbSNP
rs1222795726 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol APOC3   
Synonyms APOCIII, HALP2
Description apolipoprotein C3
Transcript NM_000040   
Expression
Putative miRNA Targets on APOC3
3'UTR of APOC3
(miRNA target sites are highlighted)
>APOC3|NM_000040|3'UTR
   1 GACCTCAATACCCCAAGTCCACCTGCCTATCCATCCTGCGAGCTCCTTGGGTCCTGCAATCTCCAGGGCTGCCCCTGTAG
  81 GTTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACCCCACCTCATGCCTGGCCCCCCTCCAGGCATGCTGGCCTCCC
 161 AATAAAGCTGGACAAGAAGCTGCTATG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' acGGUCGGA--GCGGGUCg 5'
            ||| |||  :|||::| 
Target 5' ccCCA-CCTCATGCCTGGc 3'
118 - 135 104.00 -17.60
2
miRNA  3' acGGUCGGAGCGGGUcg 5'
            ||| || :|||:|  
Target 5' gtCCA-CC-TGCCTAtc 3'
17 - 31 97.00 -12.40
3
miRNA  3' acGGUCGGAGCGGGucg 5'
            ||||   :||||   
Target 5' ctCCAGGGCTGCCCctg 3'
61 - 77 95.00 -12.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1192804 150 ClinVar
COSN31593193 8 COSMIC
COSN5853221 26 COSMIC
COSN26966431 37 COSMIC
COSN30524141 39 COSMIC
COSN28809870 41 COSMIC
COSN26966429 60 COSMIC
COSN19699555 72 COSMIC
COSN30447161 141 COSMIC
COSN30161517 150 COSMIC
rs5128 41 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1303323958 4 dbSNP
rs980623602 5 dbSNP
rs1333003201 6 dbSNP
rs548741530 9 dbSNP
rs1369165982 10 dbSNP
rs748747574 11 dbSNP
rs1446566018 18 dbSNP
rs756891658 19 dbSNP
rs758179886 19 dbSNP
rs201402310 22 dbSNP
rs927467188 23 dbSNP
rs930776786 25 dbSNP
rs1265313409 26 dbSNP
rs745586339 27 dbSNP
rs1186999885 30 dbSNP
rs1175319729 31 dbSNP
rs1315935892 32 dbSNP
rs772397071 35 dbSNP
rs201360025 36 dbSNP
rs5128 41 dbSNP
rs1235861534 46 dbSNP
rs769165532 47 dbSNP
rs776707156 49 dbSNP
rs761832101 50 dbSNP
rs765406427 51 dbSNP
rs773273781 52 dbSNP
rs763333861 53 dbSNP
rs907124040 59 dbSNP
rs1282860322 64 dbSNP
rs1377177486 69 dbSNP
rs900866832 70 dbSNP
rs4225 72 dbSNP
rs1224054370 90 dbSNP
rs1306748259 95 dbSNP
rs577085953 97 dbSNP
rs1268243427 99 dbSNP
rs539003433 100 dbSNP
rs1356038581 101 dbSNP
rs1314713789 108 dbSNP
rs1428347433 110 dbSNP
rs999953122 113 dbSNP
rs1267319833 117 dbSNP
rs1032811450 119 dbSNP
rs570839541 120 dbSNP
rs1354408383 124 dbSNP
rs1209316927 125 dbSNP
rs1402675635 126 dbSNP
rs1258996011 131 dbSNP
rs752681827 133 dbSNP
rs995893452 135 dbSNP
rs1475790219 137 dbSNP
rs1237908709 139 dbSNP
rs187628630 140 dbSNP
rs1243071828 145 dbSNP
rs1190149618 149 dbSNP
rs11540884 150 dbSNP
rs1024296488 152 dbSNP
rs1019701320 159 dbSNP
rs1232127855 161 dbSNP
rs971827928 163 dbSNP
rs980146319 174 dbSNP
rs1334964101 182 dbSNP
rs113565160 185 dbSNP
rs541512801 188 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 345.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acggucGGAGCGGGUCg 5'
                | |||||||| 
Target 5' uugcucCGUCGCCCAGg 3'
5 - 21
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760631. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_B PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000227667.3 | 3UTR | AGUCUUGCUCCGUCGCCCAGGCUGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-4486 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT254654 NF2 neurofibromin 2 2 2
MIRT458684 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT470845 PLXND1 plexin D1 2 2
MIRT493011 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT497264 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497675 SYNGR1 synaptogyrin 1 2 2
MIRT498219 TLN2 talin 2 2 2
MIRT498310 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504048 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT519959 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT531521 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT533144 WNT10A Wnt family member 10A 2 2
MIRT533541 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533681 TMEM86A transmembrane protein 86A 2 2
MIRT540321 PIGR polymeric immunoglobulin receptor 2 2
MIRT540719 GUF1 GUF1 homolog, GTPase 2 2
MIRT541566 ZNF43 zinc finger protein 43 2 4
MIRT541787 TBCCD1 TBCC domain containing 1 2 2
MIRT541925 ORC1 origin recognition complex subunit 1 2 4
MIRT542232 FUT9 fucosyltransferase 9 2 2
MIRT542285 POLR3K RNA polymerase III subunit K 2 2
MIRT542299 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 2 4
MIRT542368 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542441 C3 complement C3 2 4
MIRT542475 APOC3 apolipoprotein C3 2 2
MIRT542535 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT542640 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT542788 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT552104 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT564913 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568606 ACVR2A activin A receptor type 2A 2 2
MIRT607389 LANCL3 LanC like 3 2 2
MIRT607451 ZNF543 zinc finger protein 543 2 2
MIRT610058 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610793 KLK2 kallikrein related peptidase 2 2 2
MIRT617176 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT620579 WBSCR27 methyltransferase like 27 2 4
MIRT622085 SRPX2 sushi repeat containing protein, X-linked 2 2 2
MIRT622542 PXMP4 peroxisomal membrane protein 4 2 2
MIRT630009 PDE6B phosphodiesterase 6B 2 2
MIRT631813 PTDSS2 phosphatidylserine synthase 2 2 2
MIRT632721 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT632757 MED28 mediator complex subunit 28 2 2
MIRT634821 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT635255 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT637082 SELPLG selectin P ligand 2 2
MIRT637357 ZNF460 zinc finger protein 460 2 2
MIRT637472 DEFB105B defensin beta 105B 2 4
MIRT637504 DEFB105A defensin beta 105A 2 4
MIRT639022 AAK1 AP2 associated kinase 1 2 2
MIRT641012 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT642170 HEBP2 heme binding protein 2 2 2
MIRT648977 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT650515 UFM1 ubiquitin fold modifier 1 2 2
MIRT650949 INMT indolethylamine N-methyltransferase 2 2
MIRT658354 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT660736 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT662191 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT663045 SLC16A4 solute carrier family 16 member 4 2 2
MIRT664811 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT665161 SF3A1 splicing factor 3a subunit 1 2 4
MIRT665346 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 2
MIRT666493 SBNO1 strawberry notch homolog 1 2 2
MIRT666545 RNF115 ring finger protein 115 2 2
MIRT669351 BMP3 bone morphogenetic protein 3 2 2
MIRT669904 KIAA0754 KIAA0754 2 4
MIRT670323 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT670430 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT670672 KIAA1551 KIAA1551 2 2
MIRT670746 HOOK3 hook microtubule tethering protein 3 2 2
MIRT670998 PTGIS prostaglandin I2 synthase 2 2
MIRT671290 RPL37A ribosomal protein L37a 2 2
MIRT671469 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT671833 STIL STIL, centriolar assembly protein 2 2
MIRT673006 TAF1 TATA-box binding protein associated factor 1 2 2
MIRT675881 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT678625 OLFML2A olfactomedin like 2A 2 2
MIRT678790 NUPL2 nucleoporin like 2 2 2
MIRT679560 LIN9 lin-9 DREAM MuvB core complex component 2 2
MIRT681032 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682480 LIX1L limb and CNS expressed 1 like 2 2
MIRT682758 MDM2 MDM2 proto-oncogene 2 2
MIRT682810 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT682867 C9orf156 tRNA methyltransferase O 2 2
MIRT689233 RPS19 ribosomal protein S19 2 2
MIRT689305 C5AR2 complement component 5a receptor 2 2 2
MIRT689363 ZNF101 zinc finger protein 101 2 2
MIRT689629 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT689654 RBM23 RNA binding motif protein 23 2 2
MIRT690148 PPIL6 peptidylprolyl isomerase like 6 2 2
MIRT691407 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT691847 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT692234 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT694320 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT694365 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT696215 LYZ lysozyme 2 2
MIRT697230 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT700487 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT700612 PRKCA protein kinase C alpha 2 2
MIRT702456 KIAA1467 family with sequence similarity 234 member B 2 2
MIRT702990 HERPUD2 HERPUD family member 2 2 2
MIRT703998 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT704701 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT712481 FSTL3 follistatin like 3 2 2
MIRT712781 ZNF154 zinc finger protein 154 2 2
MIRT714369 HP1BP3 heterochromatin protein 1 binding protein 3 2 2
MIRT722570 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722839 C17orf102 chromosome 17 open reading frame 102 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4486 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4486 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4486 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (SGC-7901)
hsa-mir-4486 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4486 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4486 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission