miRTarBase - #MIRT542640


—
pre-miRNA Information
pre-miRNA hsa-mir-4486   
Genomic Coordinates chr11: 19575310 - 19575372
Description Homo sapiens miR-4486 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4486
Sequence 5| GCUGGGCGAGGCUGGCA |21
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs774299284 8 dbSNP
rs902172817 14 dbSNP
rs1222795726 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TIMM8A   
Synonyms DDP, DDP1, DFN1, MTS, TIM8
Description translocase of inner mitochondrial membrane 8A
Transcript NM_004085   
Other Transcripts NM_001145951   
Expression
Putative miRNA Targets on TIMM8A
3'UTR of TIMM8A
(miRNA target sites are highlighted)		 
>TIMM8A|NM_004085|3'UTR
   1 TCTCAGCATTACCTCTTTGGAAAAGGAAGGTAGTTCAAGAAATGAAGAGCTGTTGATGGGATGATTGAAGAAACAGCTAT
  81 GAGAGGATTGGCTCCCATCTTTTGTTACTCTTGGGACATCCTGTCATCTGAGAATGAACAAAGACCAATTTTTTGTGTGT
 161 GAAGCTTAAGGGTCATATGTTTGCTTGTATTTTTTAATGCTAATCTTGTGAAAATAATTGACAGGCGAAAGAAAACTCTA
 241 TTTAGATGCATATTACTGTACATGGGACTATGCTTTTCTCAAAGCCCCATTAACTGCTTCCTATAATTTTGATAGTGGGA
 321 CCACATACGTAAAAATCTCTCATTTGTGTGGAGTCATTTCTGATTTCAGGGGAGATCCTTGTGTTTATCAGAAAGGGCAG
 401 AAGTAGGGGAAGAATAATTTGGTATCCTTATCTAGTGTTTGATTGTCAATGCTGGAGAAAAATATCTGTAAGAGTGTTTA
 481 TACAGTACACTTCAGTTATCTTGATCTCCCTTTCCTATATGATGATTTGCTTAAATATCCATATTAAGTAAGTCTCAAGG
 561 TAGGGTAGGCAGCCTGAGAGTCTAGAGGCCTTTAGTTATAAAGGAATCTAGCCAGTGAACATAATTCTTATTACTAGACT
 641 GCCACAAGGAAGAAATTAACTTACCCTGTATATCAGGGTACAAAAAATTCAGTGATGTGCCTAAATAAGTTATAAAGATT
 721 TAGGCCAATCAGAAGCTAACAGCAGTTTCAGGTAGAGGTGCATGCCTAATGTTAGTTAGTGTAGATTCCATTTACTGCAT
 801 TCTTCTGATCACTGAAATAAAAGCTATATAAGATTCAACTCTGAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acgGUCGGA---GCGGGUCg 5'
             ||||||    |:|:|| 
Target 5' aggCAGCCTGAGAGTCTAGa 3'
 567 - 586 94.00 -17.40
2 
miRNA  3' acGGUCG--GAGCGGGUcg 5'
            :|||:  : :|||:|  
Target 5' atTCAGTGATGTGCCTAaa 3'
 687 - 705 93.00 -9.40
3 
miRNA  3' acggucgGAGCGGGUcg 5'
                 | :|||:|  
Target 5' agaggtgCATGCCTAat 3'
 754 - 770 90.00 -7.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
21394 506 ClinVar
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs185711695 25 dbSNP
rs1402589367 26 dbSNP
rs782762708 29 dbSNP
rs782801850 30 dbSNP
rs782214090 43 dbSNP
rs1455861527 46 dbSNP
rs181919155 50 dbSNP
rs1383990084 72 dbSNP
rs1447690258 79 dbSNP
rs1283007618 95 dbSNP
rs2071224 97 dbSNP
rs782076826 121 dbSNP
rs1287134051 122 dbSNP
rs1326405745 128 dbSNP
rs1205209879 129 dbSNP
rs781800592 132 dbSNP
rs1263306666 158 dbSNP
rs1441688216 174 dbSNP
rs1207751757 189 dbSNP
rs1234568207 206 dbSNP
rs3027653 226 dbSNP
rs782638910 227 dbSNP
rs1411362514 240 dbSNP
rs1471610366 245 dbSNP
rs183928551 252 dbSNP
rs1178863987 257 dbSNP
rs1407100680 263 dbSNP
rs368774526 302 dbSNP
rs1414330287 323 dbSNP
rs1332577374 324 dbSNP
rs1356843757 325 dbSNP
rs782017070 328 dbSNP
rs1348092492 329 dbSNP
rs1224803088 343 dbSNP
rs782526107 355 dbSNP
rs1343812319 358 dbSNP
rs1217311681 368 dbSNP
rs1274881402 384 dbSNP
rs782704764 396 dbSNP
rs1249454810 398 dbSNP
rs1482150675 422 dbSNP
rs1201685177 432 dbSNP
rs1378471750 435 dbSNP
rs79564479 436 dbSNP
rs1170988349 437 dbSNP
rs1422135803 443 dbSNP
rs1430726047 447 dbSNP
rs1307975942 466 dbSNP
rs781892837 468 dbSNP
rs1406285231 469 dbSNP
rs1303203720 472 dbSNP
rs1329953369 473 dbSNP
rs782102842 477 dbSNP
rs1271505027 484 dbSNP
rs1339842505 489 dbSNP
rs879947933 493 dbSNP
rs1227373875 499 dbSNP
rs868979856 500 dbSNP
rs868969312 501 dbSNP
rs1331509900 506 dbSNP
rs4024308 506 dbSNP
rs782333734 506 dbSNP
rs868980473 507 dbSNP
rs1361470087 509 dbSNP
rs1224884886 519 dbSNP
rs3027654 521 dbSNP
rs1451070908 523 dbSNP
rs1197030405 529 dbSNP
rs1244003687 530 dbSNP
rs1450554035 535 dbSNP
rs1168319805 539 dbSNP
rs1388913096 581 dbSNP
rs1427133892 583 dbSNP
rs1164299270 590 dbSNP
rs1389392320 606 dbSNP
rs1384504054 617 dbSNP
rs1319941739 627 dbSNP
rs1326655611 630 dbSNP
rs782036530 641 dbSNP
rs1295103258 649 dbSNP
rs1246665825 665 dbSNP
rs1264722467 668 dbSNP
rs1355747684 682 dbSNP
rs1208124631 688 dbSNP
rs371672469 688 dbSNP
rs78682730 688 dbSNP
rs1188110178 703 dbSNP
rs1246605640 719 dbSNP
rs1446750692 724 dbSNP
rs1188866142 745 dbSNP
rs1368383619 752 dbSNP
rs1455988813 755 dbSNP
rs1159767129 760 dbSNP
rs1388990239 775 dbSNP
rs781979163 781 dbSNP
rs1318079187 795 dbSNP
rs1408037885 805 dbSNP
rs1396336725 813 dbSNP
rs375049891 828 dbSNP
rs1242761872 832 dbSNP
rs782301849 832 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 1678.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acggucggagCGGGUCg 5'
                    |: ||| 
Target 5' --aggcuggaGUGCAGc 3'
 		1 - 15
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000372902.3 | 3UTR | AGGCUGGAGUGCAGCGGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-4486 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT254654 NF2 neurofibromin 2 2 2
MIRT458684 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT470845 PLXND1 plexin D1 2 2
MIRT493011 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT497264 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497675 SYNGR1 synaptogyrin 1 2 2
MIRT498219 TLN2 talin 2 2 2
MIRT498310 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504048 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT519959 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT531521 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT533144 WNT10A Wnt family member 10A 2 2
MIRT533541 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533681 TMEM86A transmembrane protein 86A 2 2
MIRT540321 PIGR polymeric immunoglobulin receptor 2 2
MIRT540719 GUF1 GUF1 homolog, GTPase 2 2
MIRT541566 ZNF43 zinc finger protein 43 2 4
MIRT541787 TBCCD1 TBCC domain containing 1 2 2
MIRT541925 ORC1 origin recognition complex subunit 1 2 4
MIRT542232 FUT9 fucosyltransferase 9 2 2
MIRT542285 POLR3K RNA polymerase III subunit K 2 2
MIRT542299 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 2 4
MIRT542368 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542441 C3 complement C3 2 4
MIRT542475 APOC3 apolipoprotein C3 2 2
MIRT542535 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT542640 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT542788 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT552104 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT564913 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568606 ACVR2A activin A receptor type 2A 2 2
MIRT607389 LANCL3 LanC like 3 2 2
MIRT607451 ZNF543 zinc finger protein 543 2 2
MIRT610058 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610793 KLK2 kallikrein related peptidase 2 2 2
MIRT617176 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT620579 WBSCR27 methyltransferase like 27 2 4
MIRT622085 SRPX2 sushi repeat containing protein, X-linked 2 2 2
MIRT622542 PXMP4 peroxisomal membrane protein 4 2 2
MIRT630009 PDE6B phosphodiesterase 6B 2 2
MIRT631813 PTDSS2 phosphatidylserine synthase 2 2 2
MIRT632721 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT632757 MED28 mediator complex subunit 28 2 2
MIRT634821 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT635255 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT637082 SELPLG selectin P ligand 2 2
MIRT637357 ZNF460 zinc finger protein 460 2 2
MIRT637472 DEFB105B defensin beta 105B 2 4
MIRT637504 DEFB105A defensin beta 105A 2 4
MIRT639022 AAK1 AP2 associated kinase 1 2 2
MIRT641012 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT642170 HEBP2 heme binding protein 2 2 2
MIRT648977 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT650515 UFM1 ubiquitin fold modifier 1 2 2
MIRT650949 INMT indolethylamine N-methyltransferase 2 2
MIRT658354 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT660736 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT662191 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT663045 SLC16A4 solute carrier family 16 member 4 2 2
MIRT664811 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT665161 SF3A1 splicing factor 3a subunit 1 2 4
MIRT665346 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 2
MIRT666493 SBNO1 strawberry notch homolog 1 2 2
MIRT666545 RNF115 ring finger protein 115 2 2
MIRT669351 BMP3 bone morphogenetic protein 3 2 2
MIRT669904 KIAA0754 KIAA0754 2 4
MIRT670323 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT670430 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT670672 KIAA1551 KIAA1551 2 2
MIRT670746 HOOK3 hook microtubule tethering protein 3 2 2
MIRT670998 PTGIS prostaglandin I2 synthase 2 2
MIRT671290 RPL37A ribosomal protein L37a 2 2
MIRT671469 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT671833 STIL STIL, centriolar assembly protein 2 2
MIRT673006 TAF1 TATA-box binding protein associated factor 1 2 2
MIRT675881 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT678625 OLFML2A olfactomedin like 2A 2 2
MIRT678790 NUPL2 nucleoporin like 2 2 2
MIRT679560 LIN9 lin-9 DREAM MuvB core complex component 2 2
MIRT681032 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682480 LIX1L limb and CNS expressed 1 like 2 2
MIRT682758 MDM2 MDM2 proto-oncogene 2 2
MIRT682810 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT682867 C9orf156 tRNA methyltransferase O 2 2
MIRT689233 RPS19 ribosomal protein S19 2 2
MIRT689305 C5AR2 complement component 5a receptor 2 2 2
MIRT689363 ZNF101 zinc finger protein 101 2 2
MIRT689629 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT689654 RBM23 RNA binding motif protein 23 2 2
MIRT690148 PPIL6 peptidylprolyl isomerase like 6 2 2
MIRT691407 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT691847 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT692234 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT694320 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT694365 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT696215 LYZ lysozyme 2 2
MIRT697230 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT700487 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT700612 PRKCA protein kinase C alpha 2 2
MIRT702456 KIAA1467 family with sequence similarity 234 member B 2 2
MIRT702990 HERPUD2 HERPUD family member 2 2 2
MIRT703998 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT704701 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT712481 FSTL3 follistatin like 3 2 2
MIRT712781 ZNF154 zinc finger protein 154 2 2
MIRT714369 HP1BP3 heterochromatin protein 1 binding protein 3 2 2
MIRT722570 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722839 C17orf102 chromosome 17 open reading frame 102 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4486 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4486 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4486 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (SGC-7901)
hsa-mir-4486 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4486 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4486 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission