miRTarBase - #MIRT543518


—
pre-miRNA Information
pre-miRNA hsa-mir-6830   
Genomic Coordinates chr5: 132217849 - 132217918
Description Homo sapiens miR-6830 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6830-3p
Sequence 48| UGUCUUUCUUCUCUCCCUUGCAG |70
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs772425565 6 dbSNP
rs1223446041 11 dbSNP
rs771777520 13 dbSNP
rs1416751362 14 dbSNP
rs564286593 15 dbSNP
rs748409873 17 dbSNP
rs1297884779 20 dbSNP
Putative Targets

Gene Information
Gene Symbol PRSS21   
Synonyms ESP-1, ESP1, TEST1, TESTISIN
Description protease, serine 21
Transcript NM_006799   
Other Transcripts NM_144956 , NM_144957   
Expression
Putative miRNA Targets on PRSS21
3'UTR of PRSS21
(miRNA target sites are highlighted)		 
>PRSS21|NM_006799|3'UTR
   1 GCCTACCTGAGCCCATGCAGCCTGGGGCCACTGCCAAGTCAGGCCCTGGTTCTCTTCTGTCTTGTTTGGTAATAAACACA
  81 TTCCAGTTGATGCCTTGCAGGGCATTCTTCAAAAGCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacguucccucucuucUUUCugu 5'
                          ||||   
Target 5' tgcagggcattcttcaAAAGca- 3'
 96 - 117 80.00 -7.93
2 
miRNA  3' gaCGUUCCCU-----CUCUUCUUUCUGu 5'
            ||  |||:     |  |||  ||:| 
Target 5' caGCCTGGGGCCACTGCCAAGTCAGGCc 3'
 18 - 45 73.00 -11.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30486048 14 COSMIC
COSN28183605 17 COSMIC
COSN26554302 43 COSMIC
COSN30101959 53 COSMIC
COSN30185274 62 COSMIC
COSN30509395 94 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1450155839 3 dbSNP
rs1313371544 5 dbSNP
rs781621860 9 dbSNP
rs755237354 12 dbSNP
rs374541144 14 dbSNP
rs1216510680 15 dbSNP
rs926983260 16 dbSNP
rs1318160900 17 dbSNP
rs748802017 22 dbSNP
rs1275917529 23 dbSNP
rs370653701 28 dbSNP
rs201937955 32 dbSNP
rs895766777 36 dbSNP
rs745545029 38 dbSNP
rs1191947925 39 dbSNP
rs368185851 46 dbSNP
rs1475852007 50 dbSNP
rs540765417 53 dbSNP
rs1041585123 58 dbSNP
rs1160030430 72 dbSNP
rs1439352384 81 dbSNP
rs904571649 86 dbSNP
rs558406349 88 dbSNP
rs1185553234 91 dbSNP
rs1445156211 99 dbSNP
rs1391248584 106 dbSNP
rs1042015671 111 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10942.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000455114.1 | 3UTR | UCCAUUCUCACGCUGCUAAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-6830-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081461 SSBP4 single stranded DNA binding protein 4 2 2
MIRT132029 IER5 immediate early response 5 2 2
MIRT187279 DAZAP2 DAZ associated protein 2 2 6
MIRT350303 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT350307 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT372105 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT408159 DCK deoxycytidine kinase 2 4
MIRT442623 LOX lysyl oxidase 2 2
MIRT442952 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT469401 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT476631 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT485039 TMEM189 transmembrane protein 189 2 8
MIRT485133 RASSF8 Ras association domain family member 8 2 6
MIRT498963 ORC4 origin recognition complex subunit 4 2 8
MIRT500082 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT503018 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT503374 SCAMP1 secretory carrier membrane protein 1 2 2
MIRT504975 ZNF711 zinc finger protein 711 2 2
MIRT518984 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT520754 TFDP1 transcription factor Dp-1 2 6
MIRT526785 SGCD sarcoglycan delta 2 2
MIRT533868 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT535107 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT538991 BAG4 BCL2 associated athanogene 4 2 2
MIRT543518 PRSS21 protease, serine 21 2 2
MIRT543813 SNX10 sorting nexin 10 2 2
MIRT543825 GSG1 germ cell associated 1 2 2
MIRT545334 CCDC83 coiled-coil domain containing 83 2 2
MIRT545669 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT547798 KAT7 lysine acetyltransferase 7 2 2
MIRT548068 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT549577 ZNF850 zinc finger protein 850 2 2
MIRT550753 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT550808 FAM229B family with sequence similarity 229 member B 2 2
MIRT551457 CARKD NAD(P)HX dehydratase 2 2
MIRT551852 RPS3 ribosomal protein S3 2 2
MIRT554218 SLC30A1 solute carrier family 30 member 1 2 2
MIRT556588 LEPROT leptin receptor overlapping transcript 2 2
MIRT557344 HDGF heparin binding growth factor 2 4
MIRT571945 LARP1 La ribonucleoprotein domain family member 1 2 2
MIRT574374 YY1 YY1 transcription factor 2 2
MIRT611142 CRISP1 cysteine rich secretory protein 1 2 4
MIRT611799 FCRL4 Fc receptor like 4 2 2
MIRT612834 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT617257 GLIPR1L2 GLI pathogenesis related 1 like 2 2 2
MIRT619781 NRIP2 nuclear receptor interacting protein 2 2 2
MIRT620440 SEMA3E semaphorin 3E 2 2
MIRT621725 TNR tenascin R 2 2
MIRT622905 PCDH17 protocadherin 17 2 2
MIRT623428 KLF6 Kruppel like factor 6 2 2
MIRT627856 PITPNM3 PITPNM family member 3 2 2
MIRT633894 FGF10 fibroblast growth factor 10 2 2
MIRT636257 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT640654 FRY FRY microtubule binding protein 2 2
MIRT640857 TSHZ2 teashirt zinc finger homeobox 2 2 4
MIRT641220 LRCH1 leucine rich repeats and calponin homology domain containing 1 2 2
MIRT642526 ANKRD9 ankyrin repeat domain 9 2 2
MIRT646011 TNFAIP8L2 TNF alpha induced protein 8 like 2 2 2
MIRT653317 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT657940 GATM glycine amidinotransferase 2 2
MIRT658291 FAM83F family with sequence similarity 83 member F 2 2
MIRT660607 ANTXR2 anthrax toxin receptor 2 2 2
MIRT664675 LMBR1L limb development membrane protein 1 like 2 2
MIRT664889 PRRG4 proline rich and Gla domain 4 2 2
MIRT666972 PHF20L1 PHD finger protein 20 like 1 2 2
MIRT669128 CD200 CD200 molecule 2 2
MIRT673267 RUNDC1 RUN domain containing 1 2 2
MIRT704609 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT709404 TADA2A transcriptional adaptor 2A 2 2
MIRT710963 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT711745 DTX1 deltex E3 ubiquitin ligase 1 2 2
MIRT715009 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT715467 NEGR1 neuronal growth regulator 1 2 2
MIRT715737 CD226 CD226 molecule 2 2
MIRT716526 KSR2 kinase suppressor of ras 2 2 2
MIRT718311 TMPRSS11B transmembrane protease, serine 11B 2 2
MIRT719006 TMEM184C transmembrane protein 184C 2 2
MIRT719319 STAC SH3 and cysteine rich domain 2 2
MIRT722092 SUSD1 sushi domain containing 1 2 2
MIRT723198 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT723239 BTLA B and T lymphocyte associated 2 2
MIRT724850 IGFBP5 insulin like growth factor binding protein 5 2 2

Error report submission