miRTarBase - #MIRT543736


—
pre-miRNA Information
pre-miRNA hsa-mir-1268a   
Genomic Coordinates chr15: 22225278 - 22225329
Description Homo sapiens miR-1268a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1268a
Sequence 5| CGGGCGUGGUGGUGGGGG |22
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369807489 1 dbSNP
rs537950017 2 dbSNP
rs1442921203 4 dbSNP
rs1242314811 5 dbSNP
rs28599926 6 dbSNP
rs931410682 7 dbSNP
rs1360584039 10 dbSNP
rs1245652939 12 dbSNP
rs1321701831 14 dbSNP
rs1260292644 16 dbSNP
rs879525551 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DHCR7   
Synonyms SLOS
Description 7-dehydrocholesterol reductase
Transcript NM_001163817   
Other Transcripts NM_001360   
Expression
Putative miRNA Targets on DHCR7
3'UTR of DHCR7
(miRNA target sites are highlighted)		 
>DHCR7|NM_001163817|3'UTR
   1 GGGCACGCCCTAGGGAGAAGCCCTGTGGGGCTGTCAAGAGCGTGTTCTGCCAGGTCCATGGGGGCTGGCATCCCAGCTCC
  81 AACTCGAGGAGCCTCAGTTTCCTCATCTGTAAACTGGAGAGAGCCCAGCACTTGGCAGGTGTCCAGTACCTAATCACGCT
 161 CTGTTCCTTGCTTTTGCCTTCAAGGGAATTCCGAGTGTCCAGCACTGCCGTATTGCCAGCACAGACGGATTTTCTCTAAT
 241 CAGTGTCCCTGGGGCAGGAGGATGACCCAGTCACCTTTACTAGTCCTTTGGAGACAATTTACCTGTATTAGGAGCCCAGG
 321 CCACGCTACACTCTGCCCACACTGGTGAGCAGGAGGTCTTCCCACGCCCTGTCATTAGGCTGCATTTACTCTTGCTAAAT
 401 AAAAGTGGGAGTGGGGCGTGCGCGTTATCCATGTATTGCCTTTCAGCTCTAGATCCCCCTCCCCTGCCTGCTCTGCAGTC
 481 GTGGGTGGGGCCCGTGCGCCGTTTCTCCTTGGTAGCGTGCACGGTGTTGAACTGGGACACTGGGGAGAAAGGGGCTTTCA
 561 TGTCGTTTCCTTCCTGCTCCTGCTGCACAGCTGCCAGGAGTGCTCTGCCTGGAGTCTGCAGACCTCAGAGAGGTCCCAGC
 641 ACCGGCTGTGGCCTTTCAGGTGTAGGCAGGTGGGCTCTGCTTCCCGATTCCCTGTGAGCGCCCACCCTCTCGAAAGAATT
 721 TTCTGCTTGCCCTATGACTGTGCAGACTCTGGCTCGAGCAACCCGGGGAACTTCACCCTCAGGGGCCTCCCACACCTTCT
 801 CCAGCGAGGAGGTCTCAGTCCCAGCCTCGGGAGGGCACCTCCTTTTCTGTGCTTTCTTCCCTGAGGCATTCTTCCTCATC
 881 CCTAGGGTGTTGTGTAGAACTCTTTTTAAACTCTATGCTCCGAGTAGAGTTCATCTTTATATTAAACTTCCCCTGTTCAA
 961 ATAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gggGGUGGUGGUGCGGGc 5'
             :| :| |||||||| 
Target 5' aggTCTTC-CCACGCCCt 3'
 354 - 370 146.00 -17.30
2 
miRNA  3' ggggguggugGUGCGGGc 5'
                    ||||||| 
Target 5' -------gggCACGCCCt 3'
 1 - 11 140.00 -12.50
3 
miRNA  3' ggggGUGG--UGGUGCGGGc 5'
              :|||  |:|||||:| 
Target 5' ccagTACCTAATCACGCTCt 3'
 143 - 162 136.00 -18.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
881634 4 ClinVar
881633 20 ClinVar
305950 25 ClinVar
881166 28 ClinVar
881165 57 ClinVar
881164 63 ClinVar
881163 85 ClinVar
881162 101 ClinVar
305949 119 ClinVar
305948 173 ClinVar
881161 192 ClinVar
881160 226 ClinVar
305947 261 ClinVar
305946 324 ClinVar
883536 358 ClinVar
305945 417 ClinVar
305944 424 ClinVar
305943 438 ClinVar
305942 451 ClinVar
305941 480 ClinVar
882744 565 ClinVar
305940 643 ClinVar
305939 644 ClinVar
305938 681 ClinVar
305937 700 ClinVar
882743 723 ClinVar
305936 734 ClinVar
881592 755 ClinVar
305935 761 ClinVar
305934 765 ClinVar
305933 779 ClinVar
305932 790 ClinVar
COSN20077498 6 COSMIC
COSN30180237 7 COSMIC
COSN30447000 9 COSMIC
COSN30446947 10 COSMIC
COSN19479930 13 COSMIC
COSN30144101 38 COSMIC
COSN31496337 38 COSMIC
COSN507913 41 COSMIC
COSN30118558 86 COSMIC
COSN1137354 107 COSMIC
COSN30520484 121 COSMIC
COSN30745477 135 COSMIC
COSN20077477 157 COSMIC
COSN31780316 158 COSMIC
COSN19671330 210 COSMIC
COSN17182232 228 COSMIC
COSN17037814 325 COSMIC
COSN7018579 365 COSMIC
COSN28879205 417 COSMIC
COSN8283276 424 COSMIC
COSN10091363 452 COSMIC
COSN8689648 493 COSMIC
COSN20077445 500 COSMIC
COSN32062667 604 COSMIC
COSN8689647 655 COSMIC
COSN5917869 715 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs769454033 3 dbSNP
rs371307569 4 dbSNP
rs1039813327 6 dbSNP
rs773237938 6 dbSNP
rs537515766 7 dbSNP
rs570180636 9 dbSNP
rs1261841295 11 dbSNP
rs1221481674 18 dbSNP
rs1346115369 19 dbSNP
rs747532529 20 dbSNP
rs753568521 21 dbSNP
rs1049706556 24 dbSNP
rs778207094 25 dbSNP
rs1171212772 26 dbSNP
rs114143715 28 dbSNP
rs755215281 30 dbSNP
rs769745063 31 dbSNP
rs750890505 41 dbSNP
rs201871263 42 dbSNP
rs1280076456 44 dbSNP
rs984095199 45 dbSNP
rs757059514 50 dbSNP
rs182965373 57 dbSNP
rs1421672065 58 dbSNP
rs918545080 63 dbSNP
rs546830267 64 dbSNP
rs1474760263 69 dbSNP
rs1282938298 70 dbSNP
rs11555218 83 dbSNP
rs528375215 85 dbSNP
rs1196438980 86 dbSNP
rs1264467349 90 dbSNP
rs1480414483 94 dbSNP
rs1197115830 95 dbSNP
rs1379742605 96 dbSNP
rs1466730753 101 dbSNP
rs1218650725 115 dbSNP
rs151230950 119 dbSNP
rs542228378 120 dbSNP
rs1358681796 124 dbSNP
rs143459841 131 dbSNP
rs1421541266 134 dbSNP
rs1298919316 135 dbSNP
rs1340983238 137 dbSNP
rs1025148429 139 dbSNP
rs1298906412 142 dbSNP
rs1157794816 146 dbSNP
rs1332680558 147 dbSNP
rs1468735394 148 dbSNP
rs751563187 149 dbSNP
rs1351081365 157 dbSNP
rs990638900 157 dbSNP
rs563020897 158 dbSNP
rs200229535 161 dbSNP
rs1241403555 166 dbSNP
rs373023739 169 dbSNP
rs141483210 173 dbSNP
rs753444031 173 dbSNP
rs762590224 174 dbSNP
rs1203761797 176 dbSNP
rs775040338 177 dbSNP
rs764851572 178 dbSNP
rs759235974 182 dbSNP
rs902172702 184 dbSNP
rs1381392216 191 dbSNP
rs115338563 192 dbSNP
rs771310150 193 dbSNP
rs578117764 195 dbSNP
rs747336124 196 dbSNP
rs113188310 200 dbSNP
rs1387085921 201 dbSNP
rs996784278 202 dbSNP
rs1374115399 204 dbSNP
rs1338072712 205 dbSNP
rs1398761569 207 dbSNP
rs1362277307 208 dbSNP
rs942849466 209 dbSNP
rs1424338939 210 dbSNP
rs1299572204 212 dbSNP
rs1241884432 213 dbSNP
rs888532153 214 dbSNP
rs1320659324 215 dbSNP
rs1183689879 222 dbSNP
rs185557595 226 dbSNP
rs1242081867 227 dbSNP
rs1191724954 238 dbSNP
rs1489455946 247 dbSNP
rs1287270089 250 dbSNP
rs886048617 261 dbSNP
rs1358301274 270 dbSNP
rs748234524 274 dbSNP
rs1229566407 275 dbSNP
rs1268000086 298 dbSNP
rs1802125 304 dbSNP
rs1458351015 305 dbSNP
rs939871132 305 dbSNP
rs918576144 315 dbSNP
rs759058043 324 dbSNP
rs949348159 325 dbSNP
rs763034353 335 dbSNP
rs1331663083 341 dbSNP
rs1377778445 346 dbSNP
rs949349126 347 dbSNP
rs1314258991 357 dbSNP
rs78575838 358 dbSNP
rs1218629298 362 dbSNP
rs1317421037 365 dbSNP
rs1256216413 401 dbSNP
rs550781403 403 dbSNP
rs1319210771 410 dbSNP
rs959604134 411 dbSNP
rs180885292 416 dbSNP
rs537429160 417 dbSNP
rs1293791362 418 dbSNP
rs34995793 418 dbSNP
rs570096062 421 dbSNP
rs529448827 422 dbSNP
rs1020667145 424 dbSNP
rs886048616 424 dbSNP
rs954999736 430 dbSNP
rs1028005578 431 dbSNP
rs996543491 432 dbSNP
rs1440995713 433 dbSNP
rs886048615 438 dbSNP
rs1038730132 444 dbSNP
rs11233662 451 dbSNP
rs1465630359 455 dbSNP
rs1428536002 456 dbSNP
rs1173810391 462 dbSNP
rs1030018823 464 dbSNP
rs1276919141 466 dbSNP
rs1342962711 471 dbSNP
rs1219587894 478 dbSNP
rs1790345 480 dbSNP
rs966022889 481 dbSNP
rs1212583143 490 dbSNP
rs1267754014 493 dbSNP
rs1192049010 494 dbSNP
rs1457478681 497 dbSNP
rs1018489670 498 dbSNP
rs1478766814 500 dbSNP
rs370708079 501 dbSNP
rs888616344 516 dbSNP
rs796800800 517 dbSNP
rs1177843461 519 dbSNP
rs1255951143 522 dbSNP
rs546497674 523 dbSNP
rs1401155567 524 dbSNP
rs1314358218 526 dbSNP
rs1302397750 528 dbSNP
rs1274611566 530 dbSNP
rs1239067797 539 dbSNP
rs1048492525 540 dbSNP
rs1374206333 543 dbSNP
rs1055033849 545 dbSNP
rs528351472 552 dbSNP
rs938055038 555 dbSNP
rs1353286792 561 dbSNP
rs79320071 565 dbSNP
rs1288270791 569 dbSNP
rs1489223375 570 dbSNP
rs1216493776 578 dbSNP
rs897224428 579 dbSNP
rs1046388194 584 dbSNP
rs1192730763 588 dbSNP
rs966861107 589 dbSNP
rs1438697675 598 dbSNP
rs1156239013 603 dbSNP
rs1381684866 604 dbSNP
rs914072424 608 dbSNP
rs949372640 612 dbSNP
rs548893003 613 dbSNP
rs1378054212 620 dbSNP
rs1323527077 628 dbSNP
rs955094413 629 dbSNP
rs530422056 640 dbSNP
rs1044535 643 dbSNP
rs886048614 644 dbSNP
rs1376364563 645 dbSNP
rs368948615 649 dbSNP
rs1238322446 662 dbSNP
rs576060258 665 dbSNP
rs867507859 667 dbSNP
rs1354552965 670 dbSNP
rs1224255210 677 dbSNP
rs1289003101 680 dbSNP
rs886048613 681 dbSNP
rs925088650 685 dbSNP
rs867076497 686 dbSNP
rs1440440138 691 dbSNP
rs34258235 693 dbSNP
rs1016813788 698 dbSNP
rs886048612 700 dbSNP
rs922983610 701 dbSNP
rs1199302266 703 dbSNP
rs976157431 705 dbSNP
rs1257032483 711 dbSNP
rs886918824 712 dbSNP
rs1162152520 716 dbSNP
rs1351903852 718 dbSNP
rs1024548576 723 dbSNP
rs964407302 725 dbSNP
rs7690 734 dbSNP
rs1444798186 739 dbSNP
rs879705276 739 dbSNP
rs1802378 742 dbSNP
rs1333679530 743 dbSNP
rs1377959938 744 dbSNP
rs564337568 746 dbSNP
rs1282507859 747 dbSNP
rs953018942 749 dbSNP
rs58046295 755 dbSNP
rs546098047 756 dbSNP
rs1196340516 757 dbSNP
rs886048611 761 dbSNP
rs1186141636 762 dbSNP
rs559871324 764 dbSNP
rs777137931 765 dbSNP
rs1189322273 767 dbSNP
rs1402834060 772 dbSNP
rs1464350829 776 dbSNP
rs1173320277 778 dbSNP
rs541282653 779 dbSNP
rs1417662342 780 dbSNP
rs747769421 783 dbSNP
rs12407 790 dbSNP
rs1160729690 794 dbSNP
rs1342408455 796 dbSNP
rs1055475158 800 dbSNP
rs1440537221 802 dbSNP
rs936619320 804 dbSNP
rs925162045 805 dbSNP
rs374355489 806 dbSNP
rs1042253292 807 dbSNP
rs146774511 827 dbSNP
rs1043957855 828 dbSNP
rs190840764 829 dbSNP
rs1339645389 838 dbSNP
rs1199590257 885 dbSNP
rs914187431 886 dbSNP
rs1185513420 887 dbSNP
rs185936568 889 dbSNP
rs975849227 893 dbSNP
rs1263054237 894 dbSNP
rs934184874 909 dbSNP
rs964763273 911 dbSNP
rs1257513004 913 dbSNP
rs1374049513 915 dbSNP
rs1193526587 921 dbSNP
rs1171074227 922 dbSNP
rs1487536859 930 dbSNP
rs921005639 932 dbSNP
rs1288578316 933 dbSNP
rs143699520 939 dbSNP
rs576498440 941 dbSNP
rs1398083133 946 dbSNP
rs910203440 947 dbSNP
rs758713975 960 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 1717.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gggGGUGGUGGUGCGGGc 5'
             :| :| |||||||| 
Target 5' ---UCUUC-CCACGCCCu 3'
 		1 - 14
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000407721.2 | 3UTR | UCUUCCCACGCCCUGUCAUUAGGCUGCAUUUACUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
44 hsa-miR-1268a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035845 POLR2I RNA polymerase II subunit I 1 1
MIRT035847 FASN fatty acid synthase 1 1
MIRT053736 SOX12 SRY-box 12 1 1
MIRT053737 CAMK2G calcium/calmodulin dependent protein kinase II gamma 1 1
MIRT473717 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT483654 QSOX2 quiescin sulfhydryl oxidase 2 2 4
MIRT484277 AIP aryl hydrocarbon receptor interacting protein 2 4
MIRT486674 WDR81 WD repeat domain 81 2 2
MIRT488672 WWP2 WW domain containing E3 ubiquitin protein ligase 2 2 4
MIRT493453 ITFG3 family with sequence similarity 234 member A 2 2
MIRT495902 ZNF641 zinc finger protein 641 2 2
MIRT500188 BARX1 BARX homeobox 1 2 4
MIRT512015 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT521134 SGPL1 sphingosine-1-phosphate lyase 1 2 4
MIRT530047 TRIM72 tripartite motif containing 72 2 2
MIRT531519 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT543736 DHCR7 7-dehydrocholesterol reductase 2 2
MIRT558054 EVI5L ecotropic viral integration site 5 like 2 2
MIRT569603 TRIM29 tripartite motif containing 29 2 2
MIRT570027 FAM228A family with sequence similarity 228 member A 2 2
MIRT573595 CERS1 ceramide synthase 1 2 2
MIRT623884 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT630000 PDE6B phosphodiesterase 6B 2 2
MIRT632716 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT633497 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 1
MIRT637076 SELPLG selectin P ligand 2 2
MIRT638183 TLN1 talin 1 2 2
MIRT638767 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT668073 GMPS guanine monophosphate synthase 2 2
MIRT669874 RAET1E retinoic acid early transcript 1E 2 2
MIRT670664 KIAA1551 KIAA1551 2 2
MIRT671283 RPL37A ribosomal protein L37a 2 2
MIRT675055 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT682784 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 2
MIRT683344 SCARF1 scavenger receptor class F member 1 2 2
MIRT690283 ZNF154 zinc finger protein 154 2 2
MIRT695172 SLC25A33 solute carrier family 25 member 33 2 2
MIRT695222 SCAMP3 secretory carrier membrane protein 3 2 2
MIRT700485 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT700601 PRKCA protein kinase C alpha 2 2
MIRT701410 NKRF NFKB repressing factor 2 2
MIRT703995 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT711232 RETSAT retinol saturase 2 2
MIRT719510 TMEM175 transmembrane protein 175 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1268a Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1268a Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-1268a Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1268a Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1268a Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor tissue
hsa-miR-1268a Fluorouracil 3385 NSC19893 approved resistant High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1268a Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-1268a Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-1268a Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1268a Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1268a Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87, LN229)
hsa-miR-1268a Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1268a Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (BCap37)
hsa-miR-1268a Doxorubicin 31703 NSC123127 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Etoposide 36462 NSC141540 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Vinorelbine 44424639 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-mir-1268a Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-1268a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-1268a Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-1268a Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-1268a Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-1268a Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-1268a Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1268a Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1268a Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (MDAH-2774)

Error report submission