miRTarBase - #MIRT543813


—
pre-miRNA Information
pre-miRNA hsa-mir-6830   
Genomic Coordinates chr5: 132217849 - 132217918
Description Homo sapiens miR-6830 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6830-3p
Sequence 48| UGUCUUUCUUCUCUCCCUUGCAG |70
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs772425565 6 dbSNP
rs1223446041 11 dbSNP
rs771777520 13 dbSNP
rs1416751362 14 dbSNP
rs564286593 15 dbSNP
rs748409873 17 dbSNP
rs1297884779 20 dbSNP
Putative Targets

Gene Information
Gene Symbol SNX10   
Synonyms OPTB8
Description sorting nexin 10
Transcript NM_013322   
Expression
Putative miRNA Targets on SNX10
3'UTR of SNX10
(miRNA target sites are highlighted)		 
>SNX10|NM_013322|3'UTR
   1 AAAATAATTCTAATGTTACTATCTTAGGAATAGCAAATTATGTCCAGTCATAGAGAAGAAAGCTTCATAATAATACATTC
  81 TTACCTAAAGCTCACTGTCATGATGTTAGGTATTTAAATTCTTAAAGATGTTGGGTTGTTTATTAGTGGTATTTTTATGT
 161 TGTCTTATTTTAGGTAAGCTTCTGTGTAAAGCTAAAAATCCTGTGAATACAATACTATCCTTTACAGGCAGACATTATTG
 241 GTAAACAAGATCTTGCCCTCCAATGAAATGACTTACATGTTTTAAAAAACCGAGTTGGTTTTATTGAATTTAAAAAGATA
 321 GGTAACTAAGTAGCATTTAAAATCAAGATAGAGCATTCCTTCTTGTATCAGTGGGGCAGTGTTACCATAAACACGGTGTA
 401 TATGTTGTTAAACCCTATGAAGAGTAACAGTGTAGACCAGACTGCCTCTCTCAGATATGTGCCTGATATTTTGTGGATAC
 481 CTCCCCTGCACTGGCAAAACACTATGCTTTTGGGTGTTAGACTGAAATATTTTAAGAGTATTTAACCTTTCCAGTATTCT
 561 GTTTCACGCTTAGATGGAAATGTATCTTATGAATAGAGACATATTAAAATAATGTTTACATCTTAGAAAAAACATAGATA
 641 GTGCTAGTAATATTACTTATAACTGTAATATATAGATTCAGAAATACATTTTCATTATCCAAAATCAGCTTCAACAAATG
 721 GTTTCTGGAGACAAATAATTTGTTTTCATTATCATTGTATAATCAGGTTAATGATTTATTTTTTGACTAAATGTGCAATT
 801 TCTTATCACTAGATAACTTTCAGTATCAGTGGTGGTTACTTATTACTTAAATCAGAGGAAGGATTTTATAAAGATTAATA
 881 AATTTAATTTTACCAATAAATATTCCCATAATTTAGAAAAGGATGTCGACTTGCTAATTTCAGAAATAATTATTCATTTT
 961 TAAAAAGCCCCTTTTAAAGCATCTACTTGAAGATTGGTATAATTTTCATAAAATGTCTTTTTTTTTAGTGTCCCAAAGAT
1041 ATCTTAGATAAACTATTTTGAAGTTCAGATTTCAGATGAGGCAACATTTTCTTGAGATAATTACCCAAGTTTCATCCATG
1121 TTGAATGGTACAAAATATTTCTGTGAAACTAACAGGAAGATATTTTCAGATAACTAGGATAACTTGTTGCTTTGTTACCC
1201 AGCCTAATTGAAGAGTGGCAGAGGCTACTACAAAAAGCAACCTTTTCATTTTCACTAAGAGTTTAAAAGCTATTGTATTA
1281 TTAAAAAGTCTTTACAATGCTTGTTTCAAAGAACCAACAGAAAAAAAAGCTAAGAAAACTGAGAACTAACATTAAAAAAA
1361 TTAAATTTAGAATAAGAATGATTTCTTTAATTTGTCCTTTTTTTCTTTGGTCTAAAACATTATTAAATTTTTGTAAATAT
1441 TTTGATTTAATGTGTCTTAGATCCTCATTATTTTAATACAGGAAAAGAAAAGATTTAGTAATTTCTTACCATGCTAATAT
1521 GTAAAGTTCATGCCATCCAGGCATTTAAGAGCGATCCTCATCCCTTCAGCAATATGTATTTGAGTTCACACTATTTCTGT
1601 TTTACAGCAGTTTTGAAAAACACATACTATGCCACCAATTGTCATATTATTTTTAGATGATGTAACATAGCCATCAAAAT
1681 TAATATTATGTAATGCCTAATACTTAGTATGTAAATGTCACGAGATCATTTTTACATTAAACGTGAAAAAAAATCAAAAA
1761 AAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacguucccUCUCUUCUUUCugu 5'
                   |||||||||||   
Target 5' tccagtcatAGAGAAGAAAGctt 3'
 43 - 65 130.00 -13.72
2 
miRNA  3' gaCGUUCCCUCUCU---UCUUUCUGu 5'
            |:||   | |||   ||||| || 
Target 5' ctGTAATATATAGATTCAGAAATACa 3'
 663 - 688 125.00 -8.40
3 
miRNA  3' gacguucccucUCUUCUUUCUGu 5'
                     |||:|||:||: 
Target 5' ttacttaaatcAGAGGAAGGATt 3'
 843 - 865 124.00 -11.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30130633 11 COSMIC
COSN30506165 35 COSMIC
COSN31508824 35 COSMIC
COSN31540674 45 COSMIC
COSN30518682 59 COSMIC
COSN31540222 64 COSMIC
COSN30475135 86 COSMIC
COSN31603732 103 COSMIC
COSN30448555 132 COSMIC
COSN26498409 204 COSMIC
COSN31550823 213 COSMIC
COSN2217485 272 COSMIC
COSN23649205 318 COSMIC
COSN31609763 322 COSMIC
COSN30539000 360 COSMIC
COSN22724702 404 COSMIC
COSN17182171 511 COSMIC
COSN30303990 612 COSMIC
COSN31645854 793 COSMIC
COSN27964205 953 COSMIC
COSN6876914 1080 COSMIC
COSN32200476 1095 COSMIC
COSN2217486 1248 COSMIC
COSN15661206 1278 COSMIC
COSN2217487 1324 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761958001 11 dbSNP
rs1187021201 15 dbSNP
rs772297389 18 dbSNP
rs997313699 21 dbSNP
rs571979367 22 dbSNP
rs760534954 24 dbSNP
rs1369077097 26 dbSNP
rs1453155054 33 dbSNP
rs1236069156 35 dbSNP
rs1444572684 42 dbSNP
rs766277659 50 dbSNP
rs367602157 52 dbSNP
rs966416225 64 dbSNP
rs1007477819 67 dbSNP
rs1240413893 73 dbSNP
rs185145186 77 dbSNP
rs1304568093 78 dbSNP
rs1029624346 84 dbSNP
rs1368164445 87 dbSNP
rs957652110 88 dbSNP
rs1434323337 93 dbSNP
rs532737816 103 dbSNP
rs1245111366 105 dbSNP
rs148311591 106 dbSNP
rs1020433818 130 dbSNP
rs966420476 143 dbSNP
rs978217923 146 dbSNP
rs927755192 147 dbSNP
rs938977750 149 dbSNP
rs535821721 150 dbSNP
rs1407668357 158 dbSNP
rs746804208 161 dbSNP
rs1189965206 165 dbSNP
rs1480433093 168 dbSNP
rs1438252237 175 dbSNP
rs1026458769 181 dbSNP
rs990510812 184 dbSNP
rs916495477 191 dbSNP
rs930567655 193 dbSNP
rs189061859 208 dbSNP
rs982280407 218 dbSNP
rs1303214129 228 dbSNP
rs909548014 229 dbSNP
rs926791080 234 dbSNP
rs1322291511 236 dbSNP
rs1401950429 246 dbSNP
rs1383021285 259 dbSNP
rs1288519727 271 dbSNP
rs938290850 275 dbSNP
rs1361251911 277 dbSNP
rs886243186 288 dbSNP
rs1480381810 305 dbSNP
rs1424996050 309 dbSNP
rs940552628 326 dbSNP
rs535098195 330 dbSNP
rs548723166 338 dbSNP
rs901934023 343 dbSNP
rs915260439 345 dbSNP
rs1293772658 350 dbSNP
rs1483395697 350 dbSNP
rs193016518 355 dbSNP
rs1042481960 365 dbSNP
rs537452120 372 dbSNP
rs901217941 374 dbSNP
rs934054828 377 dbSNP
rs1051634314 378 dbSNP
rs1295002297 379 dbSNP
rs1311272219 380 dbSNP
rs777004165 382 dbSNP
rs1381696060 384 dbSNP
rs1354307504 385 dbSNP
rs867967261 386 dbSNP
rs557246913 387 dbSNP
rs1401612453 395 dbSNP
rs888931360 395 dbSNP
rs577065360 396 dbSNP
rs1007510515 397 dbSNP
rs1460961833 404 dbSNP
rs539386293 406 dbSNP
rs553110319 410 dbSNP
rs1424015731 415 dbSNP
rs1257850587 416 dbSNP
rs554759925 426 dbSNP
rs1222524957 428 dbSNP
rs1011812591 429 dbSNP
rs1460727759 438 dbSNP
rs1238658157 439 dbSNP
rs1232539405 447 dbSNP
rs1456672456 455 dbSNP
rs1020507453 456 dbSNP
rs1180895198 463 dbSNP
rs898848640 464 dbSNP
rs1245632500 467 dbSNP
rs1323663391 468 dbSNP
rs967496672 484 dbSNP
rs981637033 489 dbSNP
rs1162021174 492 dbSNP
rs541488400 496 dbSNP
rs1035150095 500 dbSNP
rs1164953837 509 dbSNP
rs970491625 517 dbSNP
rs1457971513 520 dbSNP
rs1399088694 539 dbSNP
rs561454707 540 dbSNP
rs527552051 541 dbSNP
rs1380684837 547 dbSNP
rs1453474223 553 dbSNP
rs1180342161 562 dbSNP
rs574845574 568 dbSNP
rs1249741248 569 dbSNP
rs1033838433 575 dbSNP
rs1333087609 583 dbSNP
rs959506073 595 dbSNP
rs1289746772 597 dbSNP
rs1377413268 599 dbSNP
rs990870582 601 dbSNP
rs748508335 603 dbSNP
rs1245480698 604 dbSNP
rs1354771987 605 dbSNP
rs1311899698 610 dbSNP
rs989768763 632 dbSNP
rs1335618443 634 dbSNP
rs763890327 634 dbSNP
rs1386794432 636 dbSNP
rs1366867599 650 dbSNP
rs1300784754 655 dbSNP
rs1282381551 665 dbSNP
rs916286667 666 dbSNP
rs930305793 676 dbSNP
rs984668468 680 dbSNP
rs1381358805 699 dbSNP
rs907813252 707 dbSNP
rs940491467 709 dbSNP
rs1040237384 737 dbSNP
rs543799488 749 dbSNP
rs1199464197 750 dbSNP
rs978530166 754 dbSNP
rs1481400616 757 dbSNP
rs1266860003 760 dbSNP
rs1221917207 777 dbSNP
rs922592771 781 dbSNP
rs1288429902 795 dbSNP
rs934086352 798 dbSNP
rs770305603 800 dbSNP
rs1275857355 808 dbSNP
rs1236026095 812 dbSNP
rs1344239639 813 dbSNP
rs375381971 814 dbSNP
rs1461171532 817 dbSNP
rs1360725393 824 dbSNP
rs1185975079 828 dbSNP
rs910398654 840 dbSNP
rs1398644953 841 dbSNP
rs773660309 853 dbSNP
rs759104082 876 dbSNP
rs10807832 897 dbSNP
rs532828719 906 dbSNP
rs1020468315 908 dbSNP
rs10274792 917 dbSNP
rs1198699105 922 dbSNP
rs1037626138 928 dbSNP
rs899111826 929 dbSNP
rs751093358 930 dbSNP
rs1191270997 943 dbSNP
rs183666315 984 dbSNP
rs903447050 986 dbSNP
rs1003438480 993 dbSNP
rs1047875991 994 dbSNP
rs906196050 995 dbSNP
rs1222325075 1005 dbSNP
rs564654490 1018 dbSNP
rs1271470542 1021 dbSNP
rs1172408936 1026 dbSNP
rs570379033 1028 dbSNP
rs552625013 1034 dbSNP
rs1011972232 1039 dbSNP
rs1023394734 1044 dbSNP
rs1454380053 1050 dbSNP
rs1403763847 1054 dbSNP
rs1011460279 1059 dbSNP
rs141410089 1064 dbSNP
rs984470686 1078 dbSNP
rs907781631 1079 dbSNP
rs1277620216 1085 dbSNP
rs962011732 1091 dbSNP
rs967401305 1094 dbSNP
rs1475176992 1097 dbSNP
rs976318003 1101 dbSNP
rs923163038 1103 dbSNP
rs1185772345 1109 dbSNP
rs150392181 1110 dbSNP
rs1344669735 1117 dbSNP
rs1199790263 1119 dbSNP
rs1199088269 1123 dbSNP
rs1309853560 1129 dbSNP
rs1274482642 1130 dbSNP
rs1212307224 1134 dbSNP
rs1338268957 1140 dbSNP
rs1281239385 1153 dbSNP
rs760368321 1154 dbSNP
rs955329075 1165 dbSNP
rs985560228 1180 dbSNP
rs911269721 1206 dbSNP
rs1050430249 1209 dbSNP
rs548662747 1218 dbSNP
rs11772825 1225 dbSNP
rs3193526 1232 dbSNP
rs1409489583 1242 dbSNP
rs1414743271 1260 dbSNP
rs1165684723 1261 dbSNP
rs903413106 1267 dbSNP
rs1003163423 1271 dbSNP
rs1057507309 1289 dbSNP
rs1385003482 1298 dbSNP
rs1179720299 1300 dbSNP
rs929244072 1314 dbSNP
rs376300403 1321 dbSNP
rs1013111462 1324 dbSNP
rs569681918 1326 dbSNP
rs11552534 1328 dbSNP
rs1436744119 1342 dbSNP
rs1291928059 1345 dbSNP
rs1247673699 1352 dbSNP
rs906228672 1354 dbSNP
rs951805314 1355 dbSNP
rs1005873618 1363 dbSNP
rs1224137316 1372 dbSNP
rs1358651325 1378 dbSNP
rs1401924798 1382 dbSNP
rs1277728253 1385 dbSNP
rs750787869 1389 dbSNP
rs1054812903 1398 dbSNP
rs1014631368 1404 dbSNP
rs1330726899 1405 dbSNP
rs1231400003 1406 dbSNP
rs962262579 1410 dbSNP
rs1346183438 1411 dbSNP
rs1305109873 1412 dbSNP
rs1239992498 1413 dbSNP
rs1422961184 1428 dbSNP
rs1365202792 1434 dbSNP
rs1159557528 1444 dbSNP
rs894935211 1444 dbSNP
rs61162781 1459 dbSNP
rs1010650548 1460 dbSNP
rs1177112235 1467 dbSNP
rs1486985622 1467 dbSNP
rs765204221 1480 dbSNP
rs902666202 1482 dbSNP
rs923183044 1496 dbSNP
rs953191198 1497 dbSNP
rs1489684880 1502 dbSNP
rs1196355615 1509 dbSNP
rs1029894879 1512 dbSNP
rs985939125 1518 dbSNP
rs1379114160 1521 dbSNP
rs1478247943 1531 dbSNP
rs1223144454 1544 dbSNP
rs914644743 1553 dbSNP
rs947496331 1554 dbSNP
rs1403186026 1559 dbSNP
rs1157904863 1565 dbSNP
rs1378398256 1569 dbSNP
rs1345074851 1575 dbSNP
rs1299052714 1589 dbSNP
rs1041695617 1590 dbSNP
rs1159306389 1596 dbSNP
rs1343769789 1596 dbSNP
rs1415528361 1597 dbSNP
rs1432096845 1600 dbSNP
rs1390153730 1603 dbSNP
rs924603514 1630 dbSNP
rs1267619984 1634 dbSNP
rs1385263558 1639 dbSNP
rs1325797010 1640 dbSNP
rs570784487 1642 dbSNP
rs1486681671 1647 dbSNP
rs879610806 1650 dbSNP
rs539690148 1656 dbSNP
rs1258727392 1658 dbSNP
rs188035340 1660 dbSNP
rs938685863 1666 dbSNP
rs3823941 1679 dbSNP
rs758332179 1684 dbSNP
rs1356453785 1687 dbSNP
rs1322884417 1691 dbSNP
rs180762547 1694 dbSNP
rs554715352 1698 dbSNP
rs1360205023 1707 dbSNP
rs1013078016 1717 dbSNP
rs1288591364 1721 dbSNP
rs866951929 1722 dbSNP
rs555186373 1723 dbSNP
rs1006008539 1728 dbSNP
rs1269040184 1732 dbSNP
rs1468693001 1734 dbSNP
rs1015095196 1741 dbSNP
rs1170605186 1743 dbSNP
rs927853786 1744 dbSNP
rs574707199 1746 dbSNP
rs1177759433 1747 dbSNP
rs1185675606 1763 dbSNP
rs939266484 1765 dbSNP
rs897449209 1766 dbSNP
rs997609785 1767 dbSNP
rs1367913675 1797 dbSNP
rs894790109 1800 dbSNP
rs946486102 1801 dbSNP
rs1305911584 1805 dbSNP
rs1295158247 1807 dbSNP
rs1165153304 1809 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29887.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000396376.1 | 3UTR | CUUCAUAAUAAUACAUUCUUACCUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-6830-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081461 SSBP4 single stranded DNA binding protein 4 2 2
MIRT132029 IER5 immediate early response 5 2 2
MIRT187279 DAZAP2 DAZ associated protein 2 2 6
MIRT350303 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT350307 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT372105 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT408159 DCK deoxycytidine kinase 2 4
MIRT442623 LOX lysyl oxidase 2 2
MIRT442952 ASXL2 additional sex combs like 2, transcriptional regulator 2 2
MIRT469401 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT476631 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT485039 TMEM189 transmembrane protein 189 2 8
MIRT485133 RASSF8 Ras association domain family member 8 2 6
MIRT498963 ORC4 origin recognition complex subunit 4 2 8
MIRT500082 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT503018 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT503374 SCAMP1 secretory carrier membrane protein 1 2 2
MIRT504975 ZNF711 zinc finger protein 711 2 2
MIRT518984 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT520754 TFDP1 transcription factor Dp-1 2 6
MIRT526785 SGCD sarcoglycan delta 2 2
MIRT533868 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT535107 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT538991 BAG4 BCL2 associated athanogene 4 2 2
MIRT543518 PRSS21 protease, serine 21 2 2
MIRT543813 SNX10 sorting nexin 10 2 2
MIRT543825 GSG1 germ cell associated 1 2 2
MIRT545334 CCDC83 coiled-coil domain containing 83 2 2
MIRT545669 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT547798 KAT7 lysine acetyltransferase 7 2 2
MIRT548068 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT549577 ZNF850 zinc finger protein 850 2 2
MIRT550753 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT550808 FAM229B family with sequence similarity 229 member B 2 2
MIRT551457 CARKD NAD(P)HX dehydratase 2 2
MIRT551852 RPS3 ribosomal protein S3 2 2
MIRT554218 SLC30A1 solute carrier family 30 member 1 2 2
MIRT556588 LEPROT leptin receptor overlapping transcript 2 2
MIRT557344 HDGF heparin binding growth factor 2 4
MIRT571945 LARP1 La ribonucleoprotein domain family member 1 2 2
MIRT574374 YY1 YY1 transcription factor 2 2
MIRT611142 CRISP1 cysteine rich secretory protein 1 2 4
MIRT611799 FCRL4 Fc receptor like 4 2 2
MIRT612834 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT617257 GLIPR1L2 GLI pathogenesis related 1 like 2 2 2
MIRT619781 NRIP2 nuclear receptor interacting protein 2 2 2
MIRT620440 SEMA3E semaphorin 3E 2 2
MIRT621725 TNR tenascin R 2 2
MIRT622905 PCDH17 protocadherin 17 2 2
MIRT623428 KLF6 Kruppel like factor 6 2 2
MIRT627856 PITPNM3 PITPNM family member 3 2 2
MIRT633894 FGF10 fibroblast growth factor 10 2 2
MIRT636257 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT640654 FRY FRY microtubule binding protein 2 2
MIRT640857 TSHZ2 teashirt zinc finger homeobox 2 2 4
MIRT641220 LRCH1 leucine rich repeats and calponin homology domain containing 1 2 2
MIRT642526 ANKRD9 ankyrin repeat domain 9 2 2
MIRT646011 TNFAIP8L2 TNF alpha induced protein 8 like 2 2 2
MIRT653317 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT657940 GATM glycine amidinotransferase 2 2
MIRT658291 FAM83F family with sequence similarity 83 member F 2 2
MIRT660607 ANTXR2 anthrax toxin receptor 2 2 2
MIRT664675 LMBR1L limb development membrane protein 1 like 2 2
MIRT664889 PRRG4 proline rich and Gla domain 4 2 2
MIRT666972 PHF20L1 PHD finger protein 20 like 1 2 2
MIRT669128 CD200 CD200 molecule 2 2
MIRT673267 RUNDC1 RUN domain containing 1 2 2
MIRT704609 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT709404 TADA2A transcriptional adaptor 2A 2 2
MIRT710963 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT711745 DTX1 deltex E3 ubiquitin ligase 1 2 2
MIRT715009 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT715467 NEGR1 neuronal growth regulator 1 2 2
MIRT715737 CD226 CD226 molecule 2 2
MIRT716526 KSR2 kinase suppressor of ras 2 2 2
MIRT718311 TMPRSS11B transmembrane protease, serine 11B 2 2
MIRT719006 TMEM184C transmembrane protein 184C 2 2
MIRT719319 STAC SH3 and cysteine rich domain 2 2
MIRT722092 SUSD1 sushi domain containing 1 2 2
MIRT723198 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT723239 BTLA B and T lymphocyte associated 2 2
MIRT724850 IGFBP5 insulin like growth factor binding protein 5 2 2

Error report submission