miRTarBase - #MIRT544251


—
pre-miRNA Information
pre-miRNA hsa-mir-3152   
Genomic Coordinates chr9: 18573306 - 18573379
Description Homo sapiens miR-3152 stem-loop
Comment Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3152-5p
Sequence 11| AUUGCCUCUGUUCUAACACAAG |32
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1019691326 2 dbSNP
rs1282676806 8 dbSNP
rs762305650 11 dbSNP
rs1364318615 12 dbSNP
rs556364307 18 dbSNP
rs1002755159 19 dbSNP
rs1238555909 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LRIF1   
Synonyms C1orf103, RIF1
Description ligand dependent nuclear receptor interacting factor 1
Transcript NM_001006945   
Other Transcripts NM_018372   
Expression
Putative miRNA Targets on LRIF1
3'UTR of LRIF1
(miRNA target sites are highlighted)		 
>LRIF1|NM_001006945|3'UTR
   1 AATCTCCTGTAAAGACTTCAGTGAAATAGCTGTTTTTTAAAATATACTTCAGCATTAATAAGTTAATTGTAGGTGTGTTC
  81 TGAAAGTGTCTTTGAATATGAAGCTTGTTTTTTCATCAGTCGATTGTACAACTTTAAGGAATACAGAAAAGGTTGATTCA
 161 CATATGACTTGTGAATAATTTACATGGGGTATCTATACCTTTGTCTTAGATACCTTTTTTTGGAAGGATAAATTTTATAT
 241 TTTTCTATTATTTTAACTAGAATTCTCCAAGTTTGAATATTTGGGCAGGGTTTTTGTTATTGTTTGTATCTTTACCTAAA
 321 TTGCTCAGGCATTATTCCAGCAGTAGATAGTGACTGTGTATTACTGAAATTTTACAATTCAAGAGAGGAAATCAGCTCCA
 401 AACTTAGCTTTTCCAGTGGATTTGTATATGTACTTGCTTTATCTCTTTACCCTTAAAATGATGATACCTTGTATTCACCA
 481 TTGTTTTTTTTAATGTCGTGAAATAATATGTATTATGGCAACATTATTTAAACATTCAAACATTTCTCAAGAATGAGCAA
 561 CATTTGTAACTTTACAATGTAATTTTATATAATCCAAAGGTATTTTAGAATTCAGGCCATTTGATGTTTTGTTTGCTTAT
 641 AGTGATGTGTTCCCAGGCAAATGCTGCTTTTTTTTTTTTTGGGACTATGTACATACGTTACTGAGATTGTGTAAAAAGTA
 721 GATCCTGAACAGTTATCACATTTAATATTTCTTAAACTGTAAAAGTGTAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaACACAAUCUUGUCUCCGUUa 5'
            ||||||    |  |||||| 
Target 5' gaTGTGTT----CCCAGGCAAa 3'
 644 - 661 126.00 -10.60
2 
miRNA  3' gaacACAAUCUUG-----UCUCCGUUa 5'
              | ||| ||:     ||||| || 
Target 5' gaaaTTTTACAATTCAAGAGAGGAAAt 3'
 366 - 392 122.00 -7.00
3 
miRNA  3' gaACACAAUCUUGUCUCCGUUa 5'
            | | ||||||:  |||| | 
Target 5' ggTATTTTAGAATTCAGGCCAt 3'
 599 - 620 108.00 -9.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30500629 2 COSMIC
COSN31557698 4 COSMIC
COSN30466629 6 COSMIC
COSN30154130 38 COSMIC
COSN30153004 50 COSMIC
COSN31607807 57 COSMIC
COSN30128926 121 COSMIC
COSN30161377 202 COSMIC
COSN31553878 213 COSMIC
COSN8317886 412 COSMIC
COSN27436703 668 COSMIC
COSN7171993 678 COSMIC
COSN26659215 679 COSMIC
COSN27085745 679 COSMIC
COSN20095154 680 COSMIC
COSN24848575 680 COSMIC
COSN28914749 680 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1225122118 6 dbSNP
rs770535880 7 dbSNP
rs1416304301 11 dbSNP
rs759505951 14 dbSNP
rs746694252 17 dbSNP
rs377569630 19 dbSNP
rs773801419 19 dbSNP
rs373597823 22 dbSNP
rs752572420 24 dbSNP
rs1346379145 32 dbSNP
rs778889577 38 dbSNP
rs144995101 39 dbSNP
rs765918496 39 dbSNP
rs754772514 45 dbSNP
rs1232550262 48 dbSNP
rs1488971168 50 dbSNP
rs753626517 51 dbSNP
rs1422647132 53 dbSNP
rs1192702217 57 dbSNP
rs1267361721 70 dbSNP
rs756781034 78 dbSNP
rs998664441 84 dbSNP
rs1182997308 91 dbSNP
rs1407745378 98 dbSNP
rs1169228680 100 dbSNP
rs903006909 119 dbSNP
rs1406532008 121 dbSNP
rs1024169926 122 dbSNP
rs775750603 125 dbSNP
rs141022350 126 dbSNP
rs766010621 128 dbSNP
rs1187642928 135 dbSNP
rs1400593962 136 dbSNP
rs1271884001 137 dbSNP
rs1341507463 138 dbSNP
rs1212882285 140 dbSNP
rs1018503024 144 dbSNP
rs1008422509 147 dbSNP
rs1195491660 149 dbSNP
rs1488909702 150 dbSNP
rs554723599 151 dbSNP
rs1267064312 156 dbSNP
rs1490323131 161 dbSNP
rs1194969468 174 dbSNP
rs533834186 184 dbSNP
rs1474108421 187 dbSNP
rs898726011 189 dbSNP
rs1414065097 190 dbSNP
rs1426209097 190 dbSNP
rs891402794 191 dbSNP
rs1364682869 192 dbSNP
rs1420108351 198 dbSNP
rs1320125540 199 dbSNP
rs1321061009 200 dbSNP
rs3790721 203 dbSNP
rs879303964 203 dbSNP
rs1020407469 209 dbSNP
rs1383760463 213 dbSNP
rs554689181 213 dbSNP
rs893188571 219 dbSNP
rs1289893704 220 dbSNP
rs34698020 222 dbSNP
rs1359085764 223 dbSNP
rs1206105800 227 dbSNP
rs1286941953 232 dbSNP
rs1445843476 239 dbSNP
rs1214425883 240 dbSNP
rs1237601164 243 dbSNP
rs1445953832 247 dbSNP
rs764056986 249 dbSNP
rs537642666 254 dbSNP
rs185073509 263 dbSNP
rs1440011404 264 dbSNP
rs1348141635 276 dbSNP
rs1054954024 280 dbSNP
rs755898196 288 dbSNP
rs1001521193 291 dbSNP
rs908696970 297 dbSNP
rs1387061596 299 dbSNP
rs905873743 310 dbSNP
rs147314889 315 dbSNP
rs1454678186 316 dbSNP
rs949262653 320 dbSNP
rs1456654232 322 dbSNP
rs917877790 329 dbSNP
rs111891345 334 dbSNP
rs1250461101 338 dbSNP
rs1240205706 340 dbSNP
rs1281684685 341 dbSNP
rs1160489506 343 dbSNP
rs182057286 348 dbSNP
rs957618954 349 dbSNP
rs1462211655 351 dbSNP
rs1409895410 354 dbSNP
rs749688433 360 dbSNP
rs1181164762 382 dbSNP
rs149625132 383 dbSNP
rs977319657 384 dbSNP
rs1457985963 390 dbSNP
rs967328816 398 dbSNP
rs919645320 404 dbSNP
rs538458855 406 dbSNP
rs1173048452 413 dbSNP
rs1467834308 414 dbSNP
rs1268504165 415 dbSNP
rs1431370431 418 dbSNP
rs1405581803 424 dbSNP
rs772785634 424 dbSNP
rs894188055 428 dbSNP
rs371650112 429 dbSNP
rs994486433 431 dbSNP
rs1284426928 437 dbSNP
rs1326356773 438 dbSNP
rs898824463 441 dbSNP
rs1233273177 442 dbSNP
rs370369252 443 dbSNP
rs1298692625 444 dbSNP
rs763194619 447 dbSNP
rs963858374 449 dbSNP
rs1248019848 453 dbSNP
rs1436944556 455 dbSNP
rs1199954772 458 dbSNP
rs910861628 467 dbSNP
rs940273396 468 dbSNP
rs1174337355 480 dbSNP
rs887391854 481 dbSNP
rs748433903 484 dbSNP
rs1169801464 485 dbSNP
rs1394628434 492 dbSNP
rs921333456 492 dbSNP
rs934155616 492 dbSNP
rs773329273 498 dbSNP
rs1403693030 500 dbSNP
rs1283231720 506 dbSNP
rs562034357 509 dbSNP
rs1040204620 516 dbSNP
rs1387072753 519 dbSNP
rs1228981462 522 dbSNP
rs1249248067 528 dbSNP
rs1158081028 542 dbSNP
rs1338421526 555 dbSNP
rs1466555112 556 dbSNP
rs986469160 560 dbSNP
rs1489804331 563 dbSNP
rs925942466 564 dbSNP
rs1262346602 566 dbSNP
rs1453969158 574 dbSNP
rs1429133513 579 dbSNP
rs1248485911 582 dbSNP
rs1195496617 585 dbSNP
rs1190256175 588 dbSNP
rs955614597 593 dbSNP
rs967253673 602 dbSNP
rs548690117 605 dbSNP
rs1483920050 609 dbSNP
rs1367796065 623 dbSNP
rs1253716028 626 dbSNP
rs1020504071 639 dbSNP
rs992654198 641 dbSNP
rs577314355 645 dbSNP
rs958801202 646 dbSNP
rs1383408631 647 dbSNP
rs1034218131 653 dbSNP
rs531925252 657 dbSNP
rs1010324062 661 dbSNP
rs1230997259 664 dbSNP
rs1363649107 666 dbSNP
rs1318200664 667 dbSNP
rs1014533534 668 dbSNP
rs1486848033 668 dbSNP
rs563090665 669 dbSNP
rs1301164505 670 dbSNP
rs1033071136 674 dbSNP
rs546491146 675 dbSNP
rs1004510677 676 dbSNP
rs1434399434 676 dbSNP
rs1390957799 677 dbSNP
rs577613232 677 dbSNP
rs560051783 678 dbSNP
rs1481888822 679 dbSNP
rs539836179 679 dbSNP
rs1046260 680 dbSNP
rs1338226293 681 dbSNP
rs1346274522 681 dbSNP
rs1491021956 681 dbSNP
rs35004592 681 dbSNP
rs562249295 681 dbSNP
rs796963939 681 dbSNP
rs869062895 681 dbSNP
rs879134605 681 dbSNP
rs1447396974 682 dbSNP
rs67606830 684 dbSNP
rs762490033 684 dbSNP
rs779932182 684 dbSNP
rs1002011075 686 dbSNP
rs1188225602 687 dbSNP
rs1236736882 691 dbSNP
rs1444032835 692 dbSNP
rs1253544365 696 dbSNP
rs190822218 697 dbSNP
rs1483184489 702 dbSNP
rs1276251116 708 dbSNP
rs139356603 711 dbSNP
rs1014296700 712 dbSNP
rs936064035 718 dbSNP
rs1157471152 722 dbSNP
rs1337799150 732 dbSNP
rs187245349 736 dbSNP
rs926035600 757 dbSNP
rs1338205612 758 dbSNP
rs1047016168 759 dbSNP
rs201154825 759 dbSNP
rs929801446 763 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55791.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000369763.4 | 3UTR | CAAAUGCUGCUUUUUUUUUUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
75 hsa-miR-3152-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT092535 KBTBD8 kelch repeat and BTB domain containing 8 2 6
MIRT461731 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 2 2
MIRT468456 SET SET nuclear proto-oncogene 2 2
MIRT482192 AHR aryl hydrocarbon receptor 2 2
MIRT507923 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT512208 C18orf25 chromosome 18 open reading frame 25 2 6
MIRT526238 STARD4 StAR related lipid transfer domain containing 4 2 2
MIRT536131 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT536280 LIMA1 LIM domain and actin binding 1 2 2
MIRT544251 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT548054 GOLGA7 golgin A7 2 2
MIRT563443 ISCA1 iron-sulfur cluster assembly 1 2 2
MIRT565643 SIX4 SIX homeobox 4 2 2
MIRT614870 PDE12 phosphodiesterase 12 2 2
MIRT614923 MARCH6 membrane associated ring-CH-type finger 6 2 2
MIRT615793 FAM124A family with sequence similarity 124 member A 2 2
MIRT618557 VLDLR very low density lipoprotein receptor 2 2
MIRT622147 SORBS2 sorbin and SH3 domain containing 2 2 2
MIRT622390 RSBN1 round spermatid basic protein 1 2 2
MIRT624185 DDX19B DEAD-box helicase 19B 2 2
MIRT624448 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT625340 TAPBP TAP binding protein 2 2
MIRT625370 IRGQ immunity related GTPase Q 2 2
MIRT627276 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT627746 RAD54L2 RAD54 like 2 2 2
MIRT629578 RFC2 replication factor C subunit 2 2 4
MIRT630537 LGALS8 galectin 8 2 4
MIRT630559 C3orf36 chromosome 3 open reading frame 36 2 4
MIRT630568 SOWAHA sosondowah ankyrin repeat domain family member A 2 4
MIRT630763 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT635424 LRP10 LDL receptor related protein 10 2 2
MIRT636011 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 2
MIRT636337 PHAX phosphorylated adaptor for RNA export 2 2
MIRT638413 POU3F2 POU class 3 homeobox 2 2 2
MIRT639358 INIP INTS3 and NABP interacting protein 2 2
MIRT642124 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 2 4
MIRT642828 KIAA0319 KIAA0319 2 2
MIRT644017 NUCB1 nucleobindin 1 2 2
MIRT644038 WWC2 WW and C2 domain containing 2 2 2
MIRT644153 GIN1 gypsy retrotransposon integrase 1 2 2
MIRT644649 SNX9 sorting nexin 9 2 2
MIRT645798 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT647633 FAIM2 Fas apoptotic inhibitory molecule 2 2 2
MIRT648528 KIAA1143 KIAA1143 2 2
MIRT648851 PDLIM3 PDZ and LIM domain 3 2 2
MIRT648880 TUBGCP5 tubulin gamma complex associated protein 5 2 2
MIRT650777 TNFRSF10A TNF receptor superfamily member 10a 2 2
MIRT654200 RNF19B ring finger protein 19B 2 2
MIRT654508 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT655249 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT656089 MTA3 metastasis associated 1 family member 3 2 2
MIRT656599 LRRC55 leucine rich repeat containing 55 2 2
MIRT659194 CYBB cytochrome b-245 beta chain 2 2
MIRT660000 C1orf115 chromosome 1 open reading frame 115 2 4
MIRT661715 KLF8 Kruppel like factor 8 2 2
MIRT661813 PRPSAP1 phosphoribosyl pyrophosphate synthetase associated protein 1 2 2
MIRT668360 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT679734 CABP4 calcium binding protein 4 2 2
MIRT708616 NUDT18 nudix hydrolase 18 2 2
MIRT709034 TROVE2 TROVE domain family member 2 2 2
MIRT709573 DMGDH dimethylglycine dehydrogenase 2 2
MIRT709665 AJAP1 adherens junctions associated protein 1 2 2
MIRT709874 TRAF1 TNF receptor associated factor 1 2 2
MIRT710821 NLRP12 NLR family pyrin domain containing 12 2 2
MIRT710883 PARL presenilin associated rhomboid like 2 2
MIRT711547 LCAT lecithin-cholesterol acyltransferase 2 2
MIRT712017 STX1B syntaxin 1B 2 2
MIRT713058 BLVRA biliverdin reductase A 2 2
MIRT713129 THRB thyroid hormone receptor beta 2 2
MIRT713878 MOB3A MOB kinase activator 3A 2 2
MIRT714154 NXPH3 neurexophilin 3 2 2
MIRT719755 FLYWCH1 FLYWCH-type zinc finger 1 2 2
MIRT720213 KCNK1 potassium two pore domain channel subfamily K member 1 2 2
MIRT722728 BRMS1 breast cancer metastasis suppressor 1 2 2
MIRT725652 ABI2 abl interactor 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3152-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-3152-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)

Error report submission