pre-miRNA Information
pre-miRNA hsa-mir-500b   
Genomic Coordinates chrX: 50010672 - 50010750
Description Homo sapiens miR-500b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-500b-3p
Sequence 51| GCACCCAGGCAAGGAUUCUG |70
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs782140253 8 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF460   
Synonyms HZF8, ZNF272
Description zinc finger protein 460
Transcript NM_006635   
Expression
Putative miRNA Targets on ZNF460
3'UTR of ZNF460
(miRNA target sites are highlighted)
>ZNF460|NM_006635|3'UTR
   1 CAGATGTGGAAAGACTTTTTACGTACACTTCAGTCAACATCCAAGAATTCCTATTAGCGAAATAGTTTTTTAATATAACC
  81 ACTGAAGAAAATCTGTGGTGAGAGGAAACATCTTACCATCTGGTCATTCATACTGAAGAGAAACTCCATAAGTATCATCT
 161 CTGTGGGAAAACCTGTTTTAGATCATCATTTGTCATCTAAACAATTATGTTAGAAATTGACACAGCCAAGAGTCTTATTC
 241 TACATCTGATAATTCACCCATGAAAGAGACCCAGTGGTTACTGTGCACTTAGGAAAACCTTCAGCCACATCTTTCTTATT
 321 AGTTTACAGTGAAATGTTATCTCAGGGACATTCAAACAAAGGAGGAGGAGTCATAGGGAAGAGAAAGAAATGGAAGCACA
 401 GCTTCTTTCAGACTTCCCTGACAAGCCCATGGCAATTTGTCATCCCCTCCTTATTTTATTTGGGAGAGGGAAATGTTTCA
 481 GAAACAAAAGGGCCTCATCCCCTTTATTTTCCCTGTGTATACATTCACTGCTGTCCAGTGCTGTAGACAAACGGTTTGTT
 561 TGAAAACATTTTGTGAAAGCCTGCTTTGTTCCACAGCATTGTCTCCACTCTTGAGGAGCAGAAGCATATATCTTTATGAG
 641 AAAGATGGAGGCTTGAGTTATGAAATACTTTTACATTTAAGGAGATAAAGGATGTACATATGAATGGGCACATTTTACTG
 721 CACACTTCAGACGCTTTGACTTTTTTAAAAAAATTGTTTCTCCGTGTGTCTTTAACCACCCAGTACCATACTTTTTTCTT
 801 GATCTGGATCTACTTGTCAATTTCTTCTTTATTTTTCTGTAGGATGGAGATGATATTGTAGCTGTTTGTACATAATGTAA
 881 TCCAGGGAGTCCTAATTCTTCCCTCTGATTGTGGTTTCTCAGCTTTTTTACTGCTCTTTAGAGAGAGTAAATAGTTCAAA
 961 ATTCACCTCAACAATTTTCTAGAGGTCAATTTGGAACCAAAAATGAAATAAGACATGTAGCTAAAGTAAGTTAAAAGATT
1041 ATGATAAACTCAGAAAATAAACACAGAGAAGGAATCTCATTTTTCAGTCTTACAGAAGATTGTGTGAAGGCTGACTATAC
1121 ATAAAGTGACTGGAATTTTAACAGGTGAACCTGCATATGTATATGCAGGTAGTTGTCACCATGGATTGAGTCCAGTCGTA
1201 GTAATTAATATGTTTAATCAGAATATTTTGGAATTTCTCTTTTGGTATTCTTTTTGTTTCTTTTATTGTTTTTAATTGAC
1281 AATGTTTATGGGGTTTGGTGTGATATTTCAATACATGTGTGCTAAGAGTAATGATCAAATCAGGGTAATTAGCATATCCA
1361 TCTCAATCATTTATCATTTCTTTGTGTTTAGAAACATTCACAGTCTGCTTTTCTAGCTATTTGAAAATATAAAATGTATT
1441 ATTGCCAATTGTACTCATTCTGCAGTGCCACAGAACACTACAACTTATTCAAATGGAATCTTACTTGCTGTAATTTTGTA
1521 TTTGTTAACCAATCTCTATCTGCCTCTCTGCTGTCCTTCCCAGCCTCTGGTTACCACCATTCTCAACCTTTTATGCTTGC
1601 ATATGAGTAGAAACATGGAGTATTTCTCTTTCTGTGTCTAGCTTATTTCACTTAATGTCTTTCAAGCTCATTCATGTTGC
1681 TGTGAATGACAGGTTTATTTTTCATGGCTGAGTAGTATTCCATTGTGTATATATGCCATGTTTTCTTTCTTCATTCATCT
1761 GATAATGGACACTTAGACTGATTTCTTAGCTATTATGAATAGTGCTTCAATAAACATAGGAGTGTAGATCTCTCTTTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gucuuaggaacGGAC-CCACg 5'
                     :||| |||| 
Target 5' actgaagaaaaTCTGTGGTGa 3'
81 - 101 109.00 -11.60
2
miRNA  3' gucuuAGGAAC-GGACCCAcg 5'
               |:|||| :|||| |  
Target 5' cttttTTCTTGATCTGGATct 3'
791 - 811 107.00 -9.66
3
miRNA  3' gucUUAGGAA-----CGGACC-CACg 5'
             ||| :||     |::||| ||| 
Target 5' gacAATGTTTATGGGGTTTGGTGTGa 3'
1278 - 1303 105.00 -10.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30127773 23 COSMIC
COSN30502690 30 COSMIC
COSN30159005 40 COSMIC
COSN31504480 42 COSMIC
COSN1219331 47 COSMIC
COSN30503878 52 COSMIC
COSN13839101 59 COSMIC
COSN30186342 60 COSMIC
COSN31581063 60 COSMIC
COSN30466227 130 COSMIC
COSN30034020 149 COSMIC
COSN31525900 207 COSMIC
COSN1772774 230 COSMIC
COSN30760325 251 COSMIC
COSN26613283 329 COSMIC
COSN2470390 334 COSMIC
COSN25563036 506 COSMIC
COSN20116148 747 COSMIC
COSN21622466 754 COSMIC
COSN28949731 1109 COSMIC
rs12459174 1122 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1475052438 1 dbSNP
rs761316193 3 dbSNP
rs770139856 4 dbSNP
rs574950289 6 dbSNP
rs1456622314 7 dbSNP
rs772580736 13 dbSNP
rs1195151043 15 dbSNP
rs1237380583 16 dbSNP
rs1444969034 18 dbSNP
rs765913872 19 dbSNP
rs774325083 23 dbSNP
rs146064837 24 dbSNP
rs374914464 28 dbSNP
rs1165003524 29 dbSNP
rs758964592 30 dbSNP
rs1463762877 32 dbSNP
rs932156767 33 dbSNP
rs1268782266 35 dbSNP
rs1383039931 40 dbSNP
rs45618338 47 dbSNP
rs1311025169 50 dbSNP
rs532687232 54 dbSNP
rs112083299 59 dbSNP
rs551171680 60 dbSNP
rs185214458 64 dbSNP
rs902204594 65 dbSNP
rs1395767534 67 dbSNP
rs777079185 72 dbSNP
rs755518939 76 dbSNP
rs1309559949 77 dbSNP
rs562451571 94 dbSNP
rs986838350 96 dbSNP
rs908524019 111 dbSNP
rs1032689237 117 dbSNP
rs531449454 124 dbSNP
rs865801458 131 dbSNP
rs971980690 138 dbSNP
rs920511295 144 dbSNP
rs1203287947 154 dbSNP
rs930500077 159 dbSNP
rs1310493045 160 dbSNP
rs1343255044 162 dbSNP
rs1303146139 169 dbSNP
rs1232276894 176 dbSNP
rs894941104 180 dbSNP
rs1373546316 182 dbSNP
rs1045260163 186 dbSNP
rs763841073 197 dbSNP
rs1352655510 200 dbSNP
rs1330767424 202 dbSNP
rs1235590141 204 dbSNP
rs1430361553 205 dbSNP
rs753496374 213 dbSNP
rs548279744 228 dbSNP
rs758853200 233 dbSNP
rs375866255 251 dbSNP
rs1012094674 262 dbSNP
rs1425502007 263 dbSNP
rs1176100870 265 dbSNP
rs1479348805 266 dbSNP
rs1234136650 267 dbSNP
rs1056203424 270 dbSNP
rs567720216 271 dbSNP
rs892159635 273 dbSNP
rs1257096294 275 dbSNP
rs1280057367 276 dbSNP
rs1024846671 277 dbSNP
rs1341995401 282 dbSNP
rs1209248115 289 dbSNP
rs970798389 297 dbSNP
rs983971467 310 dbSNP
rs374138644 320 dbSNP
rs1410290894 322 dbSNP
rs904072469 322 dbSNP
rs1374848771 327 dbSNP
rs1310834495 328 dbSNP
rs997028012 329 dbSNP
rs1157852643 331 dbSNP
rs1416953507 334 dbSNP
rs1028887311 335 dbSNP
rs1182353853 337 dbSNP
rs780542871 343 dbSNP
rs963727237 346 dbSNP
rs973642785 354 dbSNP
rs922197971 356 dbSNP
rs1008759819 358 dbSNP
rs1015616128 362 dbSNP
rs1434390343 379 dbSNP
rs932271923 388 dbSNP
rs536956090 391 dbSNP
rs1427686341 402 dbSNP
rs1354716829 408 dbSNP
rs1170443606 414 dbSNP
rs1239746025 418 dbSNP
rs1370901526 422 dbSNP
rs920513034 423 dbSNP
rs952030152 428 dbSNP
rs1293148921 429 dbSNP
rs980641168 430 dbSNP
rs926478178 438 dbSNP
rs1159227773 439 dbSNP
rs1388751427 445 dbSNP
rs561733969 450 dbSNP
rs527437530 452 dbSNP
rs939180411 454 dbSNP
rs547264452 461 dbSNP
rs570770908 467 dbSNP
rs913644446 475 dbSNP
rs368889986 482 dbSNP
rs1307476454 489 dbSNP
rs1257225219 494 dbSNP
rs1262459807 498 dbSNP
rs912087859 500 dbSNP
rs747510641 503 dbSNP
rs868089089 512 dbSNP
rs138081768 517 dbSNP
rs79840013 520 dbSNP
rs936334827 522 dbSNP
rs568880816 525 dbSNP
rs904123374 526 dbSNP
rs1343294725 529 dbSNP
rs1053675523 536 dbSNP
rs570329452 538 dbSNP
rs1221377419 544 dbSNP
rs1264051849 549 dbSNP
rs1380360529 553 dbSNP
rs537973698 554 dbSNP
rs1320759087 555 dbSNP
rs1439732168 562 dbSNP
rs895055698 572 dbSNP
rs1166478401 574 dbSNP
rs1459897641 579 dbSNP
rs1369609235 582 dbSNP
rs142673301 599 dbSNP
rs891313848 608 dbSNP
rs1392452387 622 dbSNP
rs1189389790 627 dbSNP
rs1024794188 629 dbSNP
rs1210082430 646 dbSNP
rs1246832887 655 dbSNP
rs553750243 662 dbSNP
rs1190408117 670 dbSNP
rs1390771231 672 dbSNP
rs1423026295 674 dbSNP
rs1162353309 685 dbSNP
rs574943649 687 dbSNP
rs1488752594 691 dbSNP
rs1250726768 692 dbSNP
rs769826328 699 dbSNP
rs1225187314 701 dbSNP
rs1308981911 706 dbSNP
rs534446153 718 dbSNP
rs1233029840 722 dbSNP
rs963379471 728 dbSNP
rs1368423090 733 dbSNP
rs973805895 734 dbSNP
rs995483820 739 dbSNP
rs3833289 741 dbSNP
rs796375650 741 dbSNP
rs1298066924 742 dbSNP
rs1169698295 747 dbSNP
rs1372723688 747 dbSNP
rs76980960 747 dbSNP
rs1028990990 748 dbSNP
rs981120583 754 dbSNP
rs190061263 756 dbSNP
rs773444792 757 dbSNP
rs960856073 761 dbSNP
rs1249932579 763 dbSNP
rs1193940556 764 dbSNP
rs3746228 765 dbSNP
rs912030106 774 dbSNP
rs946223421 778 dbSNP
rs913657379 788 dbSNP
rs1276291331 791 dbSNP
rs1334611333 793 dbSNP
rs977826753 795 dbSNP
rs1300434001 796 dbSNP
rs182083810 799 dbSNP
rs145996487 808 dbSNP
rs1228263327 809 dbSNP
rs752267814 813 dbSNP
rs1308993265 820 dbSNP
rs774130763 821 dbSNP
rs1245026121 822 dbSNP
rs1267155787 825 dbSNP
rs894836341 827 dbSNP
rs947923527 828 dbSNP
rs141412974 832 dbSNP
rs1050472070 838 dbSNP
rs891372032 845 dbSNP
rs1046366284 847 dbSNP
rs1252515096 851 dbSNP
rs906325789 854 dbSNP
rs576060460 855 dbSNP
rs1036235067 856 dbSNP
rs995575736 857 dbSNP
rs1027008113 859 dbSNP
rs1349588507 862 dbSNP
rs905898302 872 dbSNP
rs541952302 877 dbSNP
rs1001534395 878 dbSNP
rs561859684 881 dbSNP
rs1352833581 882 dbSNP
rs1289477255 888 dbSNP
rs1414733585 897 dbSNP
rs1034020547 898 dbSNP
rs1248113522 905 dbSNP
rs1336559000 906 dbSNP
rs1396825402 910 dbSNP
rs3746227 927 dbSNP
rs1156873516 935 dbSNP
rs139943011 938 dbSNP
rs994955884 951 dbSNP
rs1412836452 954 dbSNP
rs1180069810 962 dbSNP
rs1474193095 963 dbSNP
rs1028939988 964 dbSNP
rs1238922116 970 dbSNP
rs992012724 972 dbSNP
rs1446041146 973 dbSNP
rs564112339 980 dbSNP
rs1210241276 985 dbSNP
rs966521670 1004 dbSNP
rs1009078441 1010 dbSNP
rs11666061 1013 dbSNP
rs1233134652 1014 dbSNP
rs566120492 1016 dbSNP
rs186412310 1025 dbSNP
rs1318741254 1027 dbSNP
rs1455845660 1027 dbSNP
rs1437579290 1034 dbSNP
rs1389395302 1035 dbSNP
rs1322566859 1039 dbSNP
rs1325307065 1044 dbSNP
rs1459795314 1047 dbSNP
rs1415935922 1050 dbSNP
rs1345879520 1059 dbSNP
rs767499803 1064 dbSNP
rs1371148211 1065 dbSNP
rs1190038601 1066 dbSNP
rs1465068312 1067 dbSNP
rs1251826649 1076 dbSNP
rs775221021 1080 dbSNP
rs912823050 1080 dbSNP
rs1381767611 1112 dbSNP
rs1292695715 1115 dbSNP
rs367813986 1118 dbSNP
rs12459174 1122 dbSNP
rs1230802321 1124 dbSNP
rs1366283952 1128 dbSNP
rs548281230 1133 dbSNP
rs1326563261 1136 dbSNP
rs377052027 1144 dbSNP
rs1048990261 1148 dbSNP
rs1268153815 1150 dbSNP
rs1351717554 1152 dbSNP
rs188417331 1160 dbSNP
rs180783809 1161 dbSNP
rs1035672793 1164 dbSNP
rs756939099 1166 dbSNP
rs1449688462 1173 dbSNP
rs940659332 1176 dbSNP
rs1478703684 1177 dbSNP
rs371488109 1177 dbSNP
rs1246807533 1186 dbSNP
rs1222878429 1191 dbSNP
rs1036587722 1194 dbSNP
rs1013537760 1196 dbSNP
rs899028651 1198 dbSNP
rs185199828 1199 dbSNP
rs1369741459 1202 dbSNP
rs979254333 1203 dbSNP
rs751938489 1205 dbSNP
rs35677391 1206 dbSNP
rs889073730 1206 dbSNP
rs1008859043 1208 dbSNP
rs1018934558 1209 dbSNP
rs1032515777 1214 dbSNP
rs1414026855 1226 dbSNP
rs968032531 1234 dbSNP
rs557121148 1240 dbSNP
rs142101923 1243 dbSNP
rs1425177727 1257 dbSNP
rs912257395 1260 dbSNP
rs943686589 1264 dbSNP
rs1250296068 1267 dbSNP
rs972998668 1269 dbSNP
rs1483558142 1281 dbSNP
rs573797462 1281 dbSNP
rs1208196617 1283 dbSNP
rs910609857 1283 dbSNP
rs957580252 1294 dbSNP
rs559787367 1297 dbSNP
rs1279403399 1299 dbSNP
rs1048515922 1301 dbSNP
rs540140136 1304 dbSNP
rs1290099120 1305 dbSNP
rs1366266829 1308 dbSNP
rs1217030979 1309 dbSNP
rs1280648414 1315 dbSNP
rs781739088 1319 dbSNP
rs1312640819 1325 dbSNP
rs1449770983 1329 dbSNP
rs1359442585 1334 dbSNP
rs1157694880 1342 dbSNP
rs1455148851 1349 dbSNP
rs1413559552 1350 dbSNP
rs778953571 1363 dbSNP
rs1204373216 1368 dbSNP
rs1161929431 1371 dbSNP
rs1388472179 1373 dbSNP
rs916341001 1374 dbSNP
rs1255893831 1381 dbSNP
rs1180533809 1385 dbSNP
rs1484344975 1388 dbSNP
rs373292664 1391 dbSNP
rs1215378879 1395 dbSNP
rs969162155 1396 dbSNP
rs753096493 1397 dbSNP
rs1233721999 1402 dbSNP
rs1477736393 1415 dbSNP
rs927678208 1437 dbSNP
rs1228861804 1446 dbSNP
rs940591422 1449 dbSNP
rs756235755 1451 dbSNP
rs1427374002 1452 dbSNP
rs1010241351 1454 dbSNP
rs1229871476 1455 dbSNP
rs1036297128 1460 dbSNP
rs1379661067 1465 dbSNP
rs920397982 1470 dbSNP
rs1042364322 1482 dbSNP
rs930478080 1483 dbSNP
rs1390113578 1484 dbSNP
rs1050435052 1488 dbSNP
rs150753616 1489 dbSNP
rs944830911 1492 dbSNP
rs370169338 1493 dbSNP
rs1432073526 1508 dbSNP
rs1368443776 1510 dbSNP
rs964713100 1515 dbSNP
rs1040333361 1518 dbSNP
rs1330224331 1521 dbSNP
rs1425885734 1521 dbSNP
rs191240759 1530 dbSNP
rs1276056861 1532 dbSNP
rs1249977019 1533 dbSNP
rs903212697 1533 dbSNP
rs999484250 1536 dbSNP
rs140146115 1537 dbSNP
rs1488105218 1539 dbSNP
rs1263562754 1546 dbSNP
rs1344023170 1547 dbSNP
rs1033269251 1560 dbSNP
rs575218019 1580 dbSNP
rs1322038367 1589 dbSNP
rs1294590165 1597 dbSNP
rs1225719968 1598 dbSNP
rs139099620 1603 dbSNP
rs1297665508 1604 dbSNP
rs1439569811 1610 dbSNP
rs1387991792 1611 dbSNP
rs1292245560 1613 dbSNP
rs1013082996 1615 dbSNP
rs1006662301 1618 dbSNP
rs1350766821 1625 dbSNP
rs542401887 1627 dbSNP
rs1447874638 1638 dbSNP
rs1392312933 1650 dbSNP
rs1189265155 1651 dbSNP
rs1451191791 1655 dbSNP
rs1265374750 1660 dbSNP
rs1192782075 1662 dbSNP
rs1019778391 1671 dbSNP
rs1273629151 1681 dbSNP
rs1219676627 1685 dbSNP
rs1248490251 1694 dbSNP
rs969110059 1694 dbSNP
rs981888582 1698 dbSNP
rs965048895 1706 dbSNP
rs749583259 1710 dbSNP
rs1302778944 1713 dbSNP
rs961753736 1714 dbSNP
rs1389030986 1722 dbSNP
rs1368990993 1723 dbSNP
rs1307786319 1724 dbSNP
rs771132097 1726 dbSNP
rs972349731 1728 dbSNP
rs972338494 1730 dbSNP
rs183098993 1733 dbSNP
rs1372818120 1735 dbSNP
rs1169399158 1739 dbSNP
rs1465734696 1741 dbSNP
rs920530116 1763 dbSNP
rs930594155 1768 dbSNP
rs1462383228 1770 dbSNP
rs79658377 1779 dbSNP
rs528351037 1784 dbSNP
rs1433675938 1788 dbSNP
rs952940793 1789 dbSNP
rs1179961456 1790 dbSNP
rs1451717253 1796 dbSNP
rs1483887520 1797 dbSNP
rs1252294000 1801 dbSNP
rs369320121 1810 dbSNP
rs1342526560 1816 dbSNP
rs944780053 1818 dbSNP
rs1233402819 1819 dbSNP
rs1324857677 1827 dbSNP
rs1288229996 1831 dbSNP
rs1325571525 1833 dbSNP
rs1350570499 1835 dbSNP
rs937488405 1835 dbSNP
rs1395656824 1837 dbSNP
rs1400390860 1838 dbSNP
rs1390490883 1840 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10794.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000360338.3 | 3UTR | CCUUACAUAUCUGGGUGCUCUGAUAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000360338.3 | 3UTR | AAUAAUAUUUGCCUUACAUAUCUGGGUGCUCUGAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000360338.3 | 3UTR | GAUCUAAUAAUAUUUGCCUUACAUAUCUGGGUGCUCUGAUAUUGGGUGCAUAUAUAUUUACAAUUUUUGUAUCCUCUUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000360338.3 | 3UTR | AUCUAAUAAUAUUUGCCUUACAUAUCUGGGUGCUCUGAUAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000360338.3 | 3UTR | CCUUACAUAUCUGGGUGCUCUGAUAUUGGGUGCAUAUAUAUUUACAAUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
172 hsa-miR-500b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059905 HDGF heparin binding growth factor 2 4
MIRT235394 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 4
MIRT442246 PYGO1 pygopus family PHD finger 1 2 2
MIRT443591 ZNF439 zinc finger protein 439 2 4
MIRT453280 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT463540 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT465589 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT469462 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT485449 KCTD15 potassium channel tetramerization domain containing 15 2 4
MIRT486682 WDR81 WD repeat domain 81 2 2
MIRT489078 POLM DNA polymerase mu 2 2
MIRT493734 GREM2 gremlin 2, DAN family BMP antagonist 2 2
MIRT494872 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT496130 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 2
MIRT496489 CHMP3 charged multivesicular body protein 3 2 2
MIRT496924 CLMN calmin 2 2
MIRT497297 TMEM119 transmembrane protein 119 2 2
MIRT499103 AGRN agrin 2 2
MIRT508979 CXorf38 chromosome X open reading frame 38 2 2
MIRT509911 NIPAL1 NIPA like domain containing 1 2 2
MIRT512820 ARRDC2 arrestin domain containing 2 2 4
MIRT512827 KBTBD6 kelch repeat and BTB domain containing 6 2 4
MIRT515360 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT516610 TRIM58 tripartite motif containing 58 2 2
MIRT517053 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT517637 ZNF491 zinc finger protein 491 2 2
MIRT518270 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT518625 STAR steroidogenic acute regulatory protein 2 2
MIRT518887 N4BP2L2 NEDD4 binding protein 2 like 2 2 2
MIRT519026 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT520365 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT521106 SLC1A5 solute carrier family 1 member 5 2 2
MIRT521943 PHC3 polyhomeotic homolog 3 2 2
MIRT522253 NPEPPS aminopeptidase puromycin sensitive 2 2
MIRT522853 KIAA1551 KIAA1551 2 2
MIRT522868 KIAA1549 KIAA1549 2 2
MIRT524207 DDX19B DEAD-box helicase 19B 2 2
MIRT526004 ARHGAP27 Rho GTPase activating protein 27 2 2
MIRT527769 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT527827 TMEM74B transmembrane protein 74B 2 2
MIRT527861 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT528040 WT1 Wilms tumor 1 2 2
MIRT529802 ZDHHC8 zinc finger DHHC-type containing 8 2 2
MIRT531723 TARS threonyl-tRNA synthetase 2 2
MIRT531996 BARD1 BRCA1 associated RING domain 1 2 2
MIRT533338 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT533621 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT533652 TMOD2 tropomodulin 2 2 2
MIRT534397 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 2 2
MIRT538686 CCDC80 coiled-coil domain containing 80 2 2
MIRT540444 RBM43 RNA binding motif protein 43 2 2
MIRT542586 ZC3H12C zinc finger CCCH-type containing 12C 2 8
MIRT542796 PLEKHA3 pleckstrin homology domain containing A3 2 4
MIRT542991 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544424 ZNF460 zinc finger protein 460 2 4
MIRT545740 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 4
MIRT552618 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT554456 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT569663 PRIM1 DNA primase subunit 1 2 2
MIRT569924 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570140 IL1RL2 interleukin 1 receptor like 2 2 2
MIRT573558 TMEM120B transmembrane protein 120B 2 2
MIRT574282 OPRD1 opioid receptor delta 1 2 2
MIRT575335 Fbxo6 F-box protein 6 2 2
MIRT607057 IDS iduronate 2-sulfatase 2 2
MIRT607078 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607500 HEBP2 heme binding protein 2 2 2
MIRT607530 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607808 RHBDL2 rhomboid like 2 2 2
MIRT608079 ZFP14 ZFP14 zinc finger protein 2 2
MIRT609119 NUDT3 nudix hydrolase 3 2 2
MIRT609745 PTCH1 patched 1 2 2
MIRT612904 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 2
MIRT618720 PCSK2 proprotein convertase subtilisin/kexin type 2 2 2
MIRT618778 HLA-E major histocompatibility complex, class I, E 2 2
MIRT619015 SLC2A6 solute carrier family 2 member 6 2 2
MIRT623223 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT623819 GEMIN6 gem nuclear organelle associated protein 6 2 2
MIRT625704 OPTN optineurin 2 2
MIRT626437 CHDH choline dehydrogenase 2 2
MIRT628087 KAT7 lysine acetyltransferase 7 2 2
MIRT628936 APOB apolipoprotein B 2 2
MIRT633543 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634348 SGOL1 shugoshin 1 2 2
MIRT634611 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635243 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT636681 BTLA B and T lymphocyte associated 2 2
MIRT636923 ZNF845 zinc finger protein 845 2 2
MIRT637606 ZNF554 zinc finger protein 554 2 2
MIRT639242 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT640835 POLR3A RNA polymerase III subunit A 2 2
MIRT642098 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT643087 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643934 C17orf104 meiosis specific with coiled-coil domain 2 2
MIRT644353 FXN frataxin 2 2
MIRT645628 SF3A3 splicing factor 3a subunit 3 2 2
MIRT645754 FAM213A family with sequence similarity 213 member A 2 2
MIRT646329 MVB12B multivesicular body subunit 12B 2 2
MIRT646817 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT647019 ADCY2 adenylate cyclase 2 2 2
MIRT647621 IGSF9B immunoglobulin superfamily member 9B 2 2
MIRT648517 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648871 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649620 ITPKC inositol-trisphosphate 3-kinase C 2 2
MIRT650062 CCDC134 coiled-coil domain containing 134 2 2
MIRT650734 TNFSF8 TNF superfamily member 8 2 2
MIRT652389 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT654352 RBM27 RNA binding motif protein 27 2 2
MIRT655796 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT657329 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 2
MIRT657734 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT660613 ANO6 anoctamin 6 2 2
MIRT661243 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT662245 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662921 MED18 mediator complex subunit 18 2 2
MIRT662963 JPH2 junctophilin 2 2 2
MIRT663347 ZNF74 zinc finger protein 74 2 2
MIRT663528 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663547 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663977 ZNF786 zinc finger protein 786 2 2
MIRT664084 METTL2B methyltransferase like 2B 2 2
MIRT664358 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664421 TIGD6 tigger transposable element derived 6 2 2
MIRT664476 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664979 TDRD1 tudor domain containing 1 2 2
MIRT665128 PYCRL pyrroline-5-carboxylate reductase 3 2 2
MIRT666259 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666321 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666881 POLQ DNA polymerase theta 2 2
MIRT668469 FADS6 fatty acid desaturase 6 2 2
MIRT669554 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669835 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT670185 CCDC142 coiled-coil domain containing 142 2 2
MIRT672020 PXMP4 peroxisomal membrane protein 4 2 2
MIRT672070 KIAA0930 KIAA0930 2 2
MIRT672475 RTTN rotatin 2 2
MIRT672851 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT673090 AK1 adenylate kinase 1 2 2
MIRT673581 KDELC2 KDEL motif containing 2 2 2
MIRT674586 SLC35B4 solute carrier family 35 member B4 2 2
MIRT675001 STRN3 striatin 3 2 2
MIRT679018 MTMR10 myotubularin related protein 10 2 2
MIRT679680 STAT3 signal transducer and activator of transcription 3 2 2
MIRT682833 FLG2 filaggrin family member 2 2 2
MIRT682886 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT683442 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 2
MIRT687040 RNF115 ring finger protein 115 2 2
MIRT691957 RHOH ras homolog family member H 2 2
MIRT694625 ZFPM1 zinc finger protein, FOG family member 1 2 2
MIRT695637 SLC26A2 solute carrier family 26 member 2 2 2
MIRT697640 WRN Werner syndrome RecQ like helicase 2 2
MIRT702009 MIDN midnolin 2 2
MIRT702034 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT704789 CDK6 cyclin dependent kinase 6 2 2
MIRT705728 AMMECR1L AMMECR1 like 2 2
MIRT705879 ADM adrenomedullin 2 2
MIRT706220 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT708418 CERS4 ceramide synthase 4 2 2
MIRT709114 C3orf18 chromosome 3 open reading frame 18 2 2
MIRT709595 ITPA inosine triphosphatase 2 2
MIRT710945 MRPL45 mitochondrial ribosomal protein L45 2 2
MIRT712345 NLN neurolysin 2 2
MIRT712530 CYTH2 cytohesin 2 2 2
MIRT714019 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT717287 ARMC12 armadillo repeat containing 12 2 2
MIRT717733 FGF1 fibroblast growth factor 1 2 2
MIRT718083 CLIC5 chloride intracellular channel 5 2 2
MIRT718562 MUC20 mucin 20, cell surface associated 2 2
MIRT721639 MYLK3 myosin light chain kinase 3 2 2
MIRT722632 C8A complement C8 alpha chain 2 2
MIRT723177 CDCA4 cell division cycle associated 4 2 2
MIRT725523 FAM229B family with sequence similarity 229 member B 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-500b Methotrexate 126941 NSC740 approved resistant cell line (W1)
hsa-miR-500b-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-500b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-500b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-500b-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-500b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-500b-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)

Error report submission