pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-516b-1 |
Genomic Coordinates | chr19: 53736845 - 53736934 |
Synonyms | MIRN516-4, MIRN516B-1, MIRN516B1, MIR516B1 |
Description | Homo sapiens miR-516b-1 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases | |
pre-miRNA | hsa-mir-516b-2 |
Genomic Coordinates | chr19: 53725442 - 53725526 |
Synonyms | MIRN516-3, MIRN516B-2, MIRN516B2, MIR516B2 |
Description | Homo sapiens miR-516b-2 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-516b-3p | ||||||||||||||||||||||||||||||||||||||||||
Sequence | 56| UGCUUCCUUUCAGAGGGU |73 | ||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
Experiments | Array-cloned | ||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MED19 | ||||||||||||||||||||
Synonyms | DT2P1G7, LCMR1, MED19AS | ||||||||||||||||||||
Description | mediator complex subunit 19 | ||||||||||||||||||||
Transcript | NM_153450 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on MED19 | |||||||||||||||||||||
3'UTR of MED19 (miRNA target sites are highlighted) |
>MED19|NM_153450|3'UTR 1 GTTCCGTATGGAGCTCTGGACTCCTAAATTCCCCTGAAGAAGAAACCAATGTACTGTGGTCTCTTGGGACTTGGGACAGG 81 GACTCTAGCAGCACCTCTGTATCCTTTCTGGCCATTTGGACAAAAGCAGTTGCCCCGACTTGGGATTTTCCTGTAGTCTT 161 CAGTGGTTCATAACAGTAGAGGATTTTGAGCTTTACAGGTGATAGGTACCTAATGTCTCCTACAGAAACACCATCTGATT 241 CAGATCACAAGAAGAAGAAAAAGAAAAAAGAAGAGGATCCTGAACGGAAAAGGAAGAAGAAAGAGAAGAAGAAAAAGAAG 321 GTAGAGTAGAGGCCTATTGCCACAACCCAGTGAGTTTCCCCAGATCTCACCCCTGTCCTAAATACCCTAGAGTTCTTTGC 401 CTCAAGTTGGACCCAAGATTGAAAACCCAAGGCAGGTTGCAGGTTTCTCCTGTACAGCCTGATCAAAGCCAAGGCTAGTT 481 CCTAGTTGTTCTTACCCTGCTTCTTTCTCCCCCAGAATCGACATAGTCCAGACCACCCAGGTATGGGCAGCTCCCAGGCC 561 AGCAGCAGCAGCAGCCTACGCTAATAGGACCACTGGACTCTTTGCCAGGATGGCTTTTCCTGCTGTACTGAACCTGCTGA 641 TAAAAGCTGCCTTCCAGGCTCTTGGACACTGCCTTGGGAGCATCCTGCAGCTGGGACAGAGGCCAGCTCCTGTTGGGCTC 721 AGTTGAGACTAAGTAAATTAGGAGAGAGAGGGACATGCTTTTGTAGGCTCATCCCAGTTGGTTTTCTCATGGACATCTCT 801 TCCTCTCCCAGGAAGCTTACAATTTTCTTCTCTCTCTTTTGTGCAATTTGTCTGATTTAGGACTTGTTCTGTGTTTTCTT 881 TAAAAAAAAAAAAATTACATTTATCAAACTGGCAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 219541.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000337672.2 | 3UTR | CUUACAAUUUUCUUCUCUCUCUUUUGUGCAAUUUGUCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000337672.2 | 3UTR | CUUACAAUUUUCUUCUCUCUCUUUUGUGCAAUUUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
85 hsa-miR-516b-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT077049 | SMARCE1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | 2 | 2 | ||||||||
MIRT155261 | IFNAR2 | interferon alpha and beta receptor subunit 2 | 2 | 4 | ||||||||
MIRT446119 | ASTN1 | astrotactin 1 | 2 | 2 | ||||||||
MIRT447355 | STOM | stomatin | 2 | 2 | ||||||||
MIRT469329 | RGP1 | RGP1 homolog, RAB6A GEF complex partner 1 | 2 | 2 | ||||||||
MIRT470201 | PSAT1 | phosphoserine aminotransferase 1 | 2 | 6 | ||||||||
MIRT475944 | GXYLT1 | glucoside xylosyltransferase 1 | 2 | 4 | ||||||||
MIRT498268 | KIAA1644 | KIAA1644 | 2 | 2 | ||||||||
MIRT501725 | OVOL1 | ovo like transcriptional repressor 1 | 2 | 2 | ||||||||
MIRT522860 | KIAA1551 | KIAA1551 | 2 | 2 | ||||||||
MIRT527900 | B3GALT5 | beta-1,3-galactosyltransferase 5 | 2 | 4 | ||||||||
MIRT528557 | DNAAF3 | dynein axonemal assembly factor 3 | 2 | 2 | ||||||||
MIRT531250 | peptide deformylase, mitochondrial | 2 | 2 | |||||||||
MIRT534410 | SENP1 | SUMO1/sentrin specific peptidase 1 | 2 | 2 | ||||||||
MIRT544656 | MED19 | mediator complex subunit 19 | 2 | 2 | ||||||||
MIRT550681 | YARS | tyrosyl-tRNA synthetase | 2 | 2 | ||||||||
MIRT557208 | HNRNPF | heterogeneous nuclear ribonucleoprotein F | 2 | 4 | ||||||||
MIRT611532 | DDB1 | damage specific DNA binding protein 1 | 2 | 2 | ||||||||
MIRT612087 | TIMM10 | translocase of inner mitochondrial membrane 10 | 2 | 2 | ||||||||
MIRT616535 | PARD6B | par-6 family cell polarity regulator beta | 2 | 4 | ||||||||
MIRT616738 | DCTN5 | dynactin subunit 5 | 2 | 2 | ||||||||
MIRT616754 | SVOP | SV2 related protein | 2 | 4 | ||||||||
MIRT617380 | FAM227A | family with sequence similarity 227 member A | 2 | 2 | ||||||||
MIRT617624 | RAB3IP | RAB3A interacting protein | 2 | 2 | ||||||||
MIRT620778 | MT1A | metallothionein 1A | 2 | 2 | ||||||||
MIRT623172 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | 2 | 2 | ||||||||
MIRT626034 | AREL1 | apoptosis resistant E3 ubiquitin protein ligase 1 | 2 | 2 | ||||||||
MIRT627376 | PRICKLE4 | prickle planar cell polarity protein 4 | 2 | 2 | ||||||||
MIRT630533 | AGO3 | argonaute 3, RISC catalytic component | 2 | 2 | ||||||||
MIRT631686 | NQO2 | N-ribosyldihydronicotinamide:quinone reductase 2 | 2 | 2 | ||||||||
MIRT633896 | FGF10 | fibroblast growth factor 10 | 2 | 2 | ||||||||
MIRT635933 | PLA2G12A | phospholipase A2 group XIIA | 2 | 2 | ||||||||
MIRT636275 | RFFL | ring finger and FYVE like domain containing E3 ubiquitin protein ligase | 2 | 2 | ||||||||
MIRT636285 | RAD51L3-RFFL | RAD51L3-RFFL readthrough | 2 | 2 | ||||||||
MIRT636502 | GDAP1L1 | ganglioside induced differentiation associated protein 1 like 1 | 2 | 2 | ||||||||
MIRT638037 | SHPK | sedoheptulokinase | 2 | 2 | ||||||||
MIRT639162 | LAMTOR3 | late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 | 2 | 2 | ||||||||
MIRT639571 | GORASP1 | golgi reassembly stacking protein 1 | 2 | 2 | ||||||||
MIRT641248 | CENPN | centromere protein N | 2 | 2 | ||||||||
MIRT643650 | MYOCD | myocardin | 2 | 2 | ||||||||
MIRT645490 | TRIM63 | tripartite motif containing 63 | 2 | 2 | ||||||||
MIRT648016 | SLCO4C1 | solute carrier organic anion transporter family member 4C1 | 2 | 2 | ||||||||
MIRT648102 | LRRFIP1 | LRR binding FLII interacting protein 1 | 2 | 2 | ||||||||
MIRT648729 | HIST1H2BD | histone cluster 1 H2B family member d | 2 | 2 | ||||||||
MIRT650177 | LILRA2 | leukocyte immunoglobulin like receptor A2 | 2 | 2 | ||||||||
MIRT652787 | TCEANC2 | transcription elongation factor A N-terminal and central domain containing 2 | 2 | 2 | ||||||||
MIRT653248 | SORD | sorbitol dehydrogenase | 2 | 2 | ||||||||
MIRT654859 | PPM1F | protein phosphatase, Mg2+/Mn2+ dependent 1F | 2 | 2 | ||||||||
MIRT655533 | PAG1 | phosphoprotein membrane anchor with glycosphingolipid microdomains 1 | 2 | 2 | ||||||||
MIRT656390 | MCU | mitochondrial calcium uniporter | 2 | 2 | ||||||||
MIRT656881 | KIF1C | kinesin family member 1C | 2 | 2 | ||||||||
MIRT657083 | JMY | junction mediating and regulatory protein, p53 cofactor | 2 | 2 | ||||||||
MIRT657629 | GPX8 | glutathione peroxidase 8 (putative) | 2 | 2 | ||||||||
MIRT658295 | FAM83F | family with sequence similarity 83 member F | 2 | 2 | ||||||||
MIRT659432 | COL1A1 | collagen type I alpha 1 chain | 2 | 2 | ||||||||
MIRT659791 | CBLB | Cbl proto-oncogene B | 2 | 2 | ||||||||
MIRT660153 | BRCC3 | BRCA1/BRCA2-containing complex subunit 3 | 2 | 2 | ||||||||
MIRT660490 | ARRDC3 | arrestin domain containing 3 | 2 | 2 | ||||||||
MIRT660503 | ARPC2 | actin related protein 2/3 complex subunit 2 | 2 | 2 | ||||||||
MIRT666356 | SIKE1 | suppressor of IKBKE 1 | 2 | 2 | ||||||||
MIRT677774 | FKTN | fukutin | 2 | 2 | ||||||||
MIRT688556 | DCAF16 | DDB1 and CUL4 associated factor 16 | 2 | 2 | ||||||||
MIRT697415 | ZFP91 | ZFP91 zinc finger protein | 2 | 2 | ||||||||
MIRT709468 | KRTAP19-1 | keratin associated protein 19-1 | 2 | 2 | ||||||||
MIRT711154 | WDR82P1 | WD repeat domain 82 pseudogene 1 | 2 | 2 | ||||||||
MIRT711467 | SRD5A1 | steroid 5 alpha-reductase 1 | 2 | 2 | ||||||||
MIRT712515 | ENPP5 | ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) | 2 | 2 | ||||||||
MIRT712661 | PCTP | phosphatidylcholine transfer protein | 2 | 2 | ||||||||
MIRT713304 | TYRP1 | tyrosinase related protein 1 | 2 | 2 | ||||||||
MIRT714597 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | 2 | 2 | ||||||||
MIRT716603 | MPPED1 | metallophosphoesterase domain containing 1 | 2 | 2 | ||||||||
MIRT717537 | PYGO2 | pygopus family PHD finger 2 | 2 | 2 | ||||||||
MIRT718058 | CYP3A5 | cytochrome P450 family 3 subfamily A member 5 | 2 | 2 | ||||||||
MIRT718539 | PIGQ | phosphatidylinositol glycan anchor biosynthesis class Q | 2 | 2 | ||||||||
MIRT719768 | ZNF236 | zinc finger protein 236 | 2 | 2 | ||||||||
MIRT720162 | PNPO | pyridoxamine 5'-phosphate oxidase | 2 | 2 | ||||||||
MIRT720360 | ZBTB8B | zinc finger and BTB domain containing 8B | 2 | 2 | ||||||||
MIRT721182 | HOPX | HOP homeobox | 2 | 2 | ||||||||
MIRT721278 | RAD54L2 | RAD54 like 2 | 2 | 2 | ||||||||
MIRT721357 | ENTHD1 | ENTH domain containing 1 | 2 | 2 | ||||||||
MIRT721504 | CARHSP1 | calcium regulated heat stable protein 1 | 2 | 2 | ||||||||
MIRT721918 | LINGO2 | leucine rich repeat and Ig domain containing 2 | 2 | 2 | ||||||||
MIRT722278 | LURAP1 | leucine rich adaptor protein 1 | 2 | 2 | ||||||||
MIRT722789 | FUT4 | fucosyltransferase 4 | 2 | 2 | ||||||||
MIRT724390 | ABAT | 4-aminobutyrate aminotransferase | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|