miRTarBase - #MIRT544686


—
pre-miRNA Information
pre-miRNA hsa-mir-4480   
Genomic Coordinates chr10: 12578753 - 12578823
Description Homo sapiens miR-4480 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4480
Sequence 44| AGCCAAGUGGAAGUUACUUUA |64
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 1 10 + 12578796 23291724, 27587585 MiREDiBase
A-to-I 12 10 + 12578807 23291724, 27587585 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs929437808 7 dbSNP
rs1454494557 9 dbSNP
rs1345041659 17 dbSNP
rs561601367 21 dbSNP
Putative Targets

Gene Information
Gene Symbol ZNF224   
Synonyms BMZF-2, BMZF2, KOX22, ZNF233, ZNF255, ZNF27
Description zinc finger protein 224
Transcript NM_013398   
Expression
Putative miRNA Targets on ZNF224
3'UTR of ZNF224
(miRNA target sites are highlighted)		 
>ZNF224|NM_013398|3'UTR
   1 TGATGTGATGGTGCAATAAAGTCTTCACTCAGTCTTCATGAATGCAGTCTCATCTGAAAGTTCACAAAGGAGAGACACAT
  81 TAAAATATGAGGCACATAGTAAGCACTTCCCTTTGAGTATTTTATCTCTGAATCCATGCTGGTGATAAATTTCACCCATT
 161 CTTGGAAGAGGGAAAACATTTGTTTAAGATAACATCAGTGCTTCAGCCATAGCTCAGCATGCCCCAGTAGTCTCAGGACC
 241 ACCATAATGGAGAATCCTTGTAAATGGTGCAATAAAGCTTCATTCAGAAGTTTGATAATTACAGCTATCATTCAGGAGAC
 321 AGGCCTTAGAAAGAGTAAGAGTTCATGAATTTACCAGACTAATGGTGGACATGTCCAAATTGATGTCCACTAGAATGTAA
 401 ACTACATGTGTCTTTGCTGCTAAGTCGTCACAGCCTTAACATTGATTAGCACTTTGTATGTGTTCAGTACTTGTTTGTTA
 481 AATCAATGAAAGGATAAAACATATGTATGGATTTGGATACAATTTTGTGTATCCAAAAAGGGAAGCCTGCAAAAAATAAT
 561 TCTGGGAAACATGAGTTGAAATGCAGAGTAAACTCAGTACTGCAATCCATAGCAATATTTTGCATATTATTATTTTTTCT
 641 TTTAAATTTTTTTCTTGATCAGATTTATCATATTCATTGAACATTATTTTATTGCACTTGGCTCCTGGCTTCCCCCCATC
 721 CTGTGCTCTGAAGTCAGAGTATTATTTGTGGCTCTATGAAATGTCCATTGCTTGTATACGGTATAAATTTAATTATCTTT
 801 TGTAGTTTTTCTCACAGTATAGACTGAAAAGGTTTGGTTAATTTTGCAATAACAGACCACTGCATATTTCACAATTAAGT
 881 GTTTTCAACAGTATTAAGGCAAGATTTACAGTAACACTTTTAAAGTGCCAGATGTACATTGACAGAAATTTTCTTAGTCA
 961 ATCCTAGATTGATCATGATTTGTGATTTCTATGCAGGCCTTGGTATGATTGCCTTTTAATTGCTGTACAATTTCTTTTTT
1041 TTTTTTAACTTCTCTGGTATAAAATATTCTAAATTTGAATGACAGCTTTTGTCAACCTTCTTATCCAATATTCTTCCACC
1121 AACGCTATGAAACAGGAAGAGAAAATGGAGTTTGGTAATTTCATCAAATATATTCATTATTGGGGGCAGGAGTAACATTT
1201 AAATCCTCCTCTTTATTGCTGGCAGTAAAAATATGTCTTTTGGAGAGCAGAACATGCCAGAATGTATAAGGTGCAACTGT
1281 TTGATATGAAAACCATAGGATAGGAAACTATGCCTATGACACTAAAACTCCAAAAAGTAGAAGACCACATTGATGATGTC
1361 ACTGCATTTTAAAATGGAAAGAACAAGTGTTCAAGAACAGGAATTTGTGTGAATTGCATTTATTCCTATAATAATATGAA
1441 CTCAATGAGATGATGACATAGACACAATAACAAAAGGAGAAAAACAATGTGGCTTTTTTTAGCCTTCATAACCTAATCAA
1521 ATAAATATCTTTGTGTGTTTTATGTTAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auuucauugAAGGUGAACCGa 5'
                   || |||||||| 
Target 5' attattttaTTGCACTTGGCt 3'
 683 - 703 152.00 -14.70
2 
miRNA  3' auuuCAUUGAAGG-------UGAACCGa 5'
              ||:|:|||:        |||||: 
Target 5' atttGTGATTTCTATGCAGGCCTTGGTa 3'
 978 - 1005 105.00 -12.36
3 
miRNA  3' auUUCAUUGAAGGUGAACCGa 5'
            :|| || |   ::||||: 
Target 5' aaGAGAAAATGGAGTTTGGTa 3'
 1137 - 1157 103.00 -5.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN512237 20 COSMIC
COSN31598240 24 COSMIC
COSN30147264 31 COSMIC
COSN30154226 38 COSMIC
COSN5268599 46 COSMIC
COSN30472698 52 COSMIC
COSN30581962 114 COSMIC
COSN6145100 127 COSMIC
COSN30601168 190 COSMIC
COSN6145101 284 COSMIC
COSN28888770 414 COSMIC
COSN26437026 428 COSMIC
COSN24400360 445 COSMIC
COSN26552986 463 COSMIC
COSN30554342 464 COSMIC
COSN25841799 613 COSMIC
COSN15771568 823 COSMIC
COSN27200574 1047 COSMIC
COSN28988591 1047 COSMIC
COSN21829532 1448 COSMIC
rs6509141 683 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760726339 8 dbSNP
rs1441298697 10 dbSNP
rs1352550197 14 dbSNP
rs757185047 16 dbSNP
rs764060045 17 dbSNP
rs753416388 19 dbSNP
rs934676056 21 dbSNP
rs756778173 31 dbSNP
rs1341164479 35 dbSNP
rs764802854 36 dbSNP
rs767470696 39 dbSNP
rs750079728 42 dbSNP
rs1353335104 43 dbSNP
rs1240532063 45 dbSNP
rs147776395 46 dbSNP
rs922489012 48 dbSNP
rs780415414 52 dbSNP
rs28681370 65 dbSNP
rs1409436995 68 dbSNP
rs1177137341 88 dbSNP
rs1468870053 90 dbSNP
rs1248840754 92 dbSNP
rs1215133474 94 dbSNP
rs1454257311 96 dbSNP
rs1468674498 98 dbSNP
rs1271962965 103 dbSNP
rs1211341338 115 dbSNP
rs889617982 125 dbSNP
rs562997699 130 dbSNP
rs1223161024 133 dbSNP
rs1443337331 135 dbSNP
rs576390113 137 dbSNP
rs905054157 141 dbSNP
rs941115892 150 dbSNP
rs1002429871 160 dbSNP
rs1394091112 165 dbSNP
rs765843158 176 dbSNP
rs753394321 178 dbSNP
rs1158950563 179 dbSNP
rs754609436 181 dbSNP
rs1217508866 198 dbSNP
rs993819040 202 dbSNP
rs545122761 211 dbSNP
rs1034669032 235 dbSNP
rs1286437536 241 dbSNP
rs995559772 243 dbSNP
rs1025652999 244 dbSNP
rs1252064551 249 dbSNP
rs951325620 256 dbSNP
rs1208717149 263 dbSNP
rs896045112 270 dbSNP
rs1014467348 273 dbSNP
rs1266623918 275 dbSNP
rs1214939050 295 dbSNP
rs1023095063 296 dbSNP
rs1315101377 311 dbSNP
rs1282175046 314 dbSNP
rs1234830576 315 dbSNP
rs1369978568 315 dbSNP
rs970671153 325 dbSNP
rs1384155546 328 dbSNP
rs1362699791 333 dbSNP
rs1195092249 337 dbSNP
rs1288403378 361 dbSNP
rs1452234024 363 dbSNP
rs565275124 366 dbSNP
rs146950865 367 dbSNP
rs1019853773 376 dbSNP
rs1477491993 378 dbSNP
rs964266832 381 dbSNP
rs1409594186 383 dbSNP
rs1429964923 389 dbSNP
rs1199829046 399 dbSNP
rs11879733 402 dbSNP
rs755865399 403 dbSNP
rs755479397 404 dbSNP
rs925089226 408 dbSNP
rs1450956768 423 dbSNP
rs781620739 427 dbSNP
rs748673023 428 dbSNP
rs769829897 429 dbSNP
rs1382585962 430 dbSNP
rs773321361 434 dbSNP
rs1172480934 437 dbSNP
rs749494520 441 dbSNP
rs771240084 443 dbSNP
rs1329412278 444 dbSNP
rs775430509 445 dbSNP
rs1447835874 446 dbSNP
rs1311124679 450 dbSNP
rs35329218 451 dbSNP
rs760491268 451 dbSNP
rs1368492844 453 dbSNP
rs763970115 454 dbSNP
rs776780393 457 dbSNP
rs761782495 459 dbSNP
rs764698396 470 dbSNP
rs749897208 473 dbSNP
rs187629286 487 dbSNP
rs1180147524 494 dbSNP
rs926530877 501 dbSNP
rs765948196 502 dbSNP
rs922605837 504 dbSNP
rs529064539 506 dbSNP
rs755393497 507 dbSNP
rs898959879 509 dbSNP
rs752293044 523 dbSNP
rs757581373 540 dbSNP
rs985818077 541 dbSNP
rs1214630318 547 dbSNP
rs781435752 548 dbSNP
rs1169135771 549 dbSNP
rs549270161 550 dbSNP
rs1419366560 556 dbSNP
rs1188627264 558 dbSNP
rs1008212231 563 dbSNP
rs1253847294 564 dbSNP
rs1197275238 581 dbSNP
rs1481085516 594 dbSNP
rs746341943 601 dbSNP
rs569103671 603 dbSNP
rs1293949685 606 dbSNP
rs1233243499 608 dbSNP
rs896888143 611 dbSNP
rs929743355 631 dbSNP
rs958205295 642 dbSNP
rs1472659959 647 dbSNP
rs1056023064 648 dbSNP
rs1180853726 655 dbSNP
rs1396214160 666 dbSNP
rs1409610143 667 dbSNP
rs1463709284 676 dbSNP
rs987870811 680 dbSNP
rs1164949609 681 dbSNP
rs1474848582 681 dbSNP
rs747582455 682 dbSNP
rs6509141 683 dbSNP
rs10419724 686 dbSNP
rs1419514867 694 dbSNP
rs1249530486 700 dbSNP
rs1197027685 702 dbSNP
rs1469957636 704 dbSNP
rs192492239 710 dbSNP
rs981735782 711 dbSNP
rs1213082560 712 dbSNP
rs1354861042 714 dbSNP
rs1045077766 716 dbSNP
rs906011711 718 dbSNP
rs926600568 719 dbSNP
rs1335590947 724 dbSNP
rs1283151328 728 dbSNP
rs1000747997 736 dbSNP
rs1331178855 739 dbSNP
rs1355168838 740 dbSNP
rs7256304 741 dbSNP
rs1444156226 757 dbSNP
rs973310784 760 dbSNP
rs1326002757 762 dbSNP
rs1306298039 769 dbSNP
rs768757776 772 dbSNP
rs533660910 780 dbSNP
rs774566222 781 dbSNP
rs1176491475 796 dbSNP
rs944052650 812 dbSNP
rs1354731366 816 dbSNP
rs1041061949 820 dbSNP
rs553415515 821 dbSNP
rs1226234986 823 dbSNP
rs955390929 826 dbSNP
rs899790597 833 dbSNP
rs1449993830 840 dbSNP
rs1286397043 843 dbSNP
rs185105764 850 dbSNP
rs34540324 853 dbSNP
rs911154359 854 dbSNP
rs1032574199 857 dbSNP
rs1236867133 861 dbSNP
rs1349046587 863 dbSNP
rs1303769021 865 dbSNP
rs962677848 872 dbSNP
rs974286423 873 dbSNP
rs893990612 884 dbSNP
rs1203729673 907 dbSNP
rs1384080157 918 dbSNP
rs536399194 918 dbSNP
rs1156615032 920 dbSNP
rs1486604056 921 dbSNP
rs1020695546 936 dbSNP
rs929689243 938 dbSNP
rs771859070 940 dbSNP
rs1173295668 965 dbSNP
rs1477142054 978 dbSNP
rs1236652927 983 dbSNP
rs1193922379 985 dbSNP
rs1446937304 992 dbSNP
rs1261742683 998 dbSNP
rs1213630076 1007 dbSNP
rs917575901 1027 dbSNP
rs1169452863 1031 dbSNP
rs1227436114 1035 dbSNP
rs1296324312 1035 dbSNP
rs1339266138 1035 dbSNP
rs551599473 1035 dbSNP
rs200555421 1036 dbSNP
rs1390980966 1041 dbSNP
rs1429358360 1047 dbSNP
rs1166778574 1048 dbSNP
rs1377419993 1049 dbSNP
rs1397089022 1053 dbSNP
rs1334153654 1055 dbSNP
rs1033772371 1060 dbSNP
rs1412997626 1078 dbSNP
rs556717410 1080 dbSNP
rs1168710733 1082 dbSNP
rs1339242448 1084 dbSNP
rs35737194 1087 dbSNP
rs1433246486 1090 dbSNP
rs1421546577 1092 dbSNP
rs1190750518 1096 dbSNP
rs947741443 1103 dbSNP
rs773031004 1106 dbSNP
rs1208385449 1119 dbSNP
rs1044753273 1121 dbSNP
rs906079765 1124 dbSNP
rs576708320 1125 dbSNP
rs929151923 1130 dbSNP
rs1227277154 1136 dbSNP
rs1235088887 1164 dbSNP
rs983274461 1167 dbSNP
rs908665079 1168 dbSNP
rs760581975 1174 dbSNP
rs376557796 1181 dbSNP
rs1041109379 1182 dbSNP
rs1329851158 1187 dbSNP
rs565165190 1191 dbSNP
rs572444336 1202 dbSNP
rs2061332 1225 dbSNP
rs1475827192 1226 dbSNP
rs1417687848 1231 dbSNP
rs1180617032 1235 dbSNP
rs932652419 1237 dbSNP
rs188107408 1246 dbSNP
rs1233787295 1248 dbSNP
rs758977567 1265 dbSNP
rs955338943 1268 dbSNP
rs1255628043 1269 dbSNP
rs1195007904 1271 dbSNP
rs1214944132 1276 dbSNP
rs1248470622 1278 dbSNP
rs1449061066 1285 dbSNP
rs1007281024 1293 dbSNP
rs1334916733 1299 dbSNP
rs1289134184 1302 dbSNP
rs1226514957 1306 dbSNP
rs530214497 1326 dbSNP
rs894050787 1329 dbSNP
rs1446348568 1330 dbSNP
rs1009732124 1332 dbSNP
rs1328007782 1334 dbSNP
rs1462091252 1338 dbSNP
rs1021081605 1339 dbSNP
rs544579187 1339 dbSNP
rs1003259504 1340 dbSNP
rs1178356537 1346 dbSNP
rs1438701573 1350 dbSNP
rs1236055296 1351 dbSNP
rs180914415 1352 dbSNP
rs1468574867 1361 dbSNP
rs1055450 1362 dbSNP
rs962915690 1390 dbSNP
rs959321270 1399 dbSNP
rs143135407 1403 dbSNP
rs994499594 1408 dbSNP
rs1028016704 1411 dbSNP
rs769428205 1428 dbSNP
rs1239074074 1431 dbSNP
rs752340960 1435 dbSNP
rs1305968421 1436 dbSNP
rs918417367 1437 dbSNP
rs950608978 1438 dbSNP
rs983326648 1448 dbSNP
rs1291815502 1453 dbSNP
rs1433522748 1454 dbSNP
rs911734094 1455 dbSNP
rs116459995 1456 dbSNP
rs1418322222 1458 dbSNP
rs551622066 1458 dbSNP
rs570923084 1459 dbSNP
rs1175172500 1472 dbSNP
rs932679313 1486 dbSNP
rs1486809358 1488 dbSNP
rs879458401 1488 dbSNP
rs767894713 1493 dbSNP
rs1295019431 1494 dbSNP
rs917641468 1506 dbSNP
rs1233250746 1524 dbSNP
rs947841654 1529 dbSNP
rs1235335249 1530 dbSNP
rs567419930 1530 dbSNP
rs924974829 1534 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' auuucauugAAGGUGAACCGa 5'
                   || |||||||| 
Target 5' -------uaUUGCACUUGGCu 3'
 		1 - 14
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7767.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' auuucauugAAGGUGAACCGa 5'
                   || |||||||| 
Target 5' auuauuuuaUUGCACUUGGCu 3'
 		4 - 24
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000336976.6 | 3UTR | UAUUGCACUUGGCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000336976.6 | 3UTR | AACAUUAUUUUAUUGCACUUGGCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
117 hsa-miR-4480 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056040 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT091259 FXR1 FMR1 autosomal homolog 1 2 4
MIRT117347 MAPRE2 microtubule associated protein RP/EB family member 2 2 2
MIRT234960 ZNF439 zinc finger protein 439 2 4
MIRT441356 ZNF75A zinc finger protein 75a 2 2
MIRT441426 STXBP2 syntaxin binding protein 2 2 2
MIRT441455 ZNF488 zinc finger protein 488 2 4
MIRT441524 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT441576 EXOC5 exocyst complex component 5 2 2
MIRT441597 ABCB5 ATP binding cassette subfamily B member 5 2 6
MIRT441610 ATP13A4 ATPase 13A4 2 2
MIRT441698 CIT citron rho-interacting serine/threonine kinase 2 2
MIRT441714 FGF9 fibroblast growth factor 9 2 2
MIRT441784 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT441795 EXOSC2 exosome component 2 2 2
MIRT441868 RNASEL ribonuclease L 2 2
MIRT441900 SLC9A8 solute carrier family 9 member A8 2 6
MIRT441919 FAM217B family with sequence similarity 217 member B 2 2
MIRT441928 C1orf109 chromosome 1 open reading frame 109 2 2
MIRT441938 RIMKLB ribosomal modification protein rimK like family member B 2 2
MIRT442157 DPY19L1 dpy-19 like C-mannosyltransferase 1 2 2
MIRT442172 AZF1 azoospermia factor 1 2 2
MIRT442208 IRS1 insulin receptor substrate 1 2 2
MIRT442237 DDX19A DEAD-box helicase 19A 2 2
MIRT442366 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT442572 SDC1 syndecan 1 2 2
MIRT442604 ZNF391 zinc finger protein 391 2 2
MIRT442609 MRC1 mannose receptor C-type 1 2 2
MIRT442647 POP4 POP4 homolog, ribonuclease P/MRP subunit 2 2
MIRT442658 OIP5 Opa interacting protein 5 2 6
MIRT442686 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT442773 JAG1 jagged 1 2 2
MIRT442785 CHD8 chromodomain helicase DNA binding protein 8 2 2
MIRT442895 PLCB3 phospholipase C beta 3 2 2
MIRT442941 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT442959 SGCD sarcoglycan delta 2 2
MIRT442998 EDAR ectodysplasin A receptor 2 2
MIRT443017 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT443064 CASP5 caspase 5 2 2
MIRT443069 ABLIM1 actin binding LIM protein 1 2 2
MIRT443208 VPS36 vacuolar protein sorting 36 homolog 2 2
MIRT443237 ANKRD26 ankyrin repeat domain 26 2 2
MIRT443253 A1CF APOBEC1 complementation factor 2 2
MIRT443329 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT443333 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT443349 STX7 syntaxin 7 2 2
MIRT443452 CLIC5 chloride intracellular channel 5 2 2
MIRT443547 GPR35 G protein-coupled receptor 35 2 2
MIRT443616 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT443626 CPSF2 cleavage and polyadenylation specific factor 2 2 2
MIRT443730 ALPK3 alpha kinase 3 2 2
MIRT443786 ST13 ST13, Hsp70 interacting protein 2 2
MIRT443852 RGS6 regulator of G protein signaling 6 2 2
MIRT445483 KLF5 Kruppel like factor 5 2 2
MIRT471105 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT472329 NETO2 neuropilin and tolloid like 2 2 4
MIRT472391 NDRG3 NDRG family member 3 2 2
MIRT473522 MAX MYC associated factor X 2 2
MIRT473874 MAFK MAF bZIP transcription factor K 2 6
MIRT476021 GTF2A1 general transcription factor IIA subunit 1 2 2
MIRT478320 DDN dendrin 2 2
MIRT492049 TNFSF9 TNF superfamily member 9 2 2
MIRT494851 ANKRD24 ankyrin repeat domain 24 2 2
MIRT494991 TSSC1 EARP complex and GARP complex interacting protein 1 2 2
MIRT495034 RASSF2 Ras association domain family member 2 2 2
MIRT495111 NOL10 nucleolar protein 10 2 2
MIRT495113 TRADD TNFRSF1A associated via death domain 2 2
MIRT495131 METTL24 methyltransferase like 24 2 2
MIRT495147 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT495297 NUP54 nucleoporin 54 2 2
MIRT495341 RTN2 reticulon 2 2 2
MIRT495347 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 2
MIRT496682 DUSP18 dual specificity phosphatase 18 2 2
MIRT496743 TGFBR1 transforming growth factor beta receptor 1 2 2
MIRT496841 KCNIP2 potassium voltage-gated channel interacting protein 2 2 2
MIRT496852 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 2 2
MIRT496889 FOXP1 forkhead box P1 2 2
MIRT496922 CLMN calmin 2 2
MIRT496990 TMEM231 transmembrane protein 231 2 2
MIRT497002 SNAP25 synaptosome associated protein 25 2 2
MIRT497058 C6orf223 chromosome 6 open reading frame 223 2 2
MIRT500529 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 6
MIRT506048 PPP6C protein phosphatase 6 catalytic subunit 2 4
MIRT512163 CD164 CD164 molecule 2 6
MIRT527051 RDH13 retinol dehydrogenase 13 2 2
MIRT532282 TNFSF14 TNF superfamily member 14 2 2
MIRT534083 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT534605 RNASEH1 ribonuclease H1 2 4
MIRT539509 ACSS3 acyl-CoA synthetase short chain family member 3 2 2
MIRT543069 ARID4B AT-rich interaction domain 4B 2 2
MIRT544233 CCBL2 kynurenine aminotransferase 3 2 2
MIRT544686 ZNF224 zinc finger protein 224 2 4
MIRT546269 TMEM30A transmembrane protein 30A 2 4
MIRT559069 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT562768 RMI2 RecQ mediated genome instability 2 2 2
MIRT563974 HCFC1 host cell factor C1 2 2
MIRT564086 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT564525 PDXP pyridoxal phosphatase 2 2
MIRT564613 ZNF703 zinc finger protein 703 2 2
MIRT566252 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT614420 ZNF440 zinc finger protein 440 2 2
MIRT618789 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT619160 PPDPF pancreatic progenitor cell differentiation and proliferation factor 2 2
MIRT641778 ZDHHC7 zinc finger DHHC-type containing 7 2 4
MIRT653680 SLC25A36 solute carrier family 25 member 36 2 2
MIRT657861 GJD2 gap junction protein delta 2 2 2
MIRT660879 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT668781 DAAM1 dishevelled associated activator of morphogenesis 1 2 4
MIRT688559 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT695393 WDR41 WD repeat domain 41 2 2
MIRT698680 TCEA1 transcription elongation factor A1 2 2
MIRT700974 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT705055 C5orf15 chromosome 5 open reading frame 15 2 2
MIRT705864 AFF1 AF4/FMR2 family member 1 2 2
MIRT710586 CDCA4 cell division cycle associated 4 2 2
MIRT713904 IGF2R insulin like growth factor 2 receptor 2 2
MIRT717133 SKI SKI proto-oncogene 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4480 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-4480 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)

Error report submission