pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-921 |
Genomic Coordinates | chr1: 166154743 - 166154798 |
Synonyms | MIRN921, hsa-mir-921, MIR921 |
Description | Homo sapiens miR-921 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-921 | ||||||||||||
Sequence | 2| CUAGUGAGGGACAGAACCAGGAUUC |26 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Cloned | DRVs in miRNA |
|
||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SNRPA1 | ||||||||||||||||||||
Synonyms | Lea1 | ||||||||||||||||||||
Description | small nuclear ribonucleoprotein polypeptide A' | ||||||||||||||||||||
Transcript | NM_003090 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SNRPA1 | |||||||||||||||||||||
3'UTR of SNRPA1 (miRNA target sites are highlighted) |
>SNRPA1|NM_003090|3'UTR 1 GCAGTGAGGCAGATGTATAATAATAGGCCCTCTTGGAACAAGTCTTGCTTTTCGAACATGGTATAATAGCCTTGTTTGTG 81 TTAGCAAAGTGGAATCTATCAGCATTGTTGAAATGCTTAAGACTGCTGCTGATAATTTTGTAATATAAGTTTTGAAATCT 161 AAATGTCAATTTTCTACAAATTATAAAAATAAACTCCACTCACTATGCTACCAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 6627.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000254193.6 | 3UTR | UCAAUUUUCUACAAAUUAUAAAAAUAAACUCCACUCACUAUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
63 hsa-miR-921 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT054764 | ANGPTL1 | angiopoietin like 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT066171 | PIP4K2C | phosphatidylinositol-5-phosphate 4-kinase type 2 gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT069409 | ZFYVE21 | zinc finger FYVE-type containing 21 | ![]() |
![]() |
2 | 8 | ||||||
MIRT102284 | DNAJB9 | DnaJ heat shock protein family (Hsp40) member B9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT107595 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT178618 | HIAT1 | major facilitator superfamily domain containing 14A | ![]() |
![]() |
2 | 2 | ||||||
MIRT182407 | TIPRL | TOR signaling pathway regulator | ![]() |
![]() |
2 | 4 | ||||||
MIRT186552 | ZBTB18 | zinc finger and BTB domain containing 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT273662 | HOXC8 | homeobox C8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT283191 | C16ORF52 | chromosome 16 open reading frame 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT284890 | NFAT5 | nuclear factor of activated T-cells 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT347670 | LSM14A | LSM14A, mRNA processing body assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT400222 | SLC35F6 | solute carrier family 35 member F6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT403517 | ASPH | aspartate beta-hydroxylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT442251 | DCTN5 | dynactin subunit 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443023 | SDR39U1 | short chain dehydrogenase/reductase family 39U member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443097 | RNF20 | ring finger protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444560 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT445696 | PRKG1 | protein kinase, cGMP-dependent, type I | ![]() |
![]() |
2 | 2 | ||||||
MIRT454084 | TMEM209 | transmembrane protein 209 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455463 | LYPLA2 | lysophospholipase II | ![]() |
![]() |
2 | 2 | ||||||
MIRT456653 | TIFA | TRAF interacting protein with forkhead associated domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT458147 | LYRM4 | LYR motif containing 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT467073 | SRRD | SRR1 domain containing | ![]() |
![]() |
2 | 4 | ||||||
MIRT467245 | SPPL2A | signal peptide peptidase like 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT468246 | SFXN4 | sideroflexin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471589 | PAQR5 | progestin and adipoQ receptor family member 5 | ![]() |
![]() |
2 | 19 | ||||||
MIRT476639 | G2E3 | G2/M-phase specific E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT482433 | ADM | adrenomedullin | ![]() |
![]() |
2 | 10 | ||||||
MIRT486848 | PERP | PERP, TP53 apoptosis effector | ![]() |
![]() |
2 | 6 | ||||||
MIRT489656 | SHMT1 | serine hydroxymethyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493441 | KANSL1 | KAT8 regulatory NSL complex subunit 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT493841 | FOXN3 | forkhead box N3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT501378 | RBFOX2 | RNA binding protein, fox-1 homolog 2 | ![]() |
![]() |
2 | 10 | ||||||
MIRT509679 | ATAD5 | ATPase family, AAA domain containing 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510280 | MED28 | mediator complex subunit 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512221 | ATXN3 | ataxin 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT514030 | BNIP2 | BCL2 interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521375 | RDX | radixin | ![]() |
![]() |
2 | 4 | ||||||
MIRT521444 | RAD51 | RAD51 recombinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT526055 | CBR1 | carbonyl reductase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528658 | FUNDC2 | FUN14 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529975 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544098 | IPMK | inositol polyphosphate multikinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT545579 | SNRPA1 | small nuclear ribonucleoprotein polypeptide A' | ![]() |
![]() |
2 | 2 | ||||||
MIRT547424 | MED4 | mediator complex subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548955 | CD2AP | CD2 associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT549537 | NDUFA6 | NADH:ubiquinone oxidoreductase subunit A6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT552550 | ZFP36L2 | ZFP36 ring finger protein like 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554640 | ROBO1 | roundabout guidance receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564904 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565578 | SLC6A8 | solute carrier family 6 member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568312 | BAG4 | BCL2 associated athanogene 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617891 | PTCHD3 | patched domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621892 | TAF13 | TATA-box binding protein associated factor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642850 | RNF135 | ring finger protein 135 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665395 | WEE1 | WEE1 G2 checkpoint kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT697879 | UBE2B | ubiquitin conjugating enzyme E2 B | ![]() |
![]() |
2 | 2 | ||||||
MIRT698492 | THOC2 | THO complex 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701227 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT701872 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT707045 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715216 | NPVF | neuropeptide VF precursor | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|