miRTarBase - #MIRT546443


—
pre-miRNA Information
pre-miRNA hsa-mir-497   
Genomic Coordinates chr17: 7017911 - 7018022
Synonyms MIRN497, hsa-mir-497, MIR497
Description Homo sapiens miR-497 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-497-3p
Sequence 64| CAAACCACACUGUGGUGUUAGA |85
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 17 - 7017957 29233923 MiREDiBase
A-to-I 4 17 - 7017956 29233923 MiREDiBase
A-to-I 20 17 - 7017940 24964909, 25521855, 27229138, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1413601274 5 dbSNP
rs1028648384 6 dbSNP
rs1479092960 9 dbSNP
rs1261056598 10 dbSNP
rs997278260 11 dbSNP
rs1324708562 13 dbSNP
rs755634302 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SNX5   
Synonyms -
Description sorting nexin 5
Transcript NM_014426   
Other Transcripts NM_152227   
Expression
Putative miRNA Targets on SNX5
3'UTR of SNX5
(miRNA target sites are highlighted)		 
>SNX5|NM_014426|3'UTR
   1 TATGCCTTCACTCAGAAGAAAAGAAATGAATGTGAAAGAAAGCCAAGCATCACTTGCACTTAAATCATTACCACGGAAGA
  81 TATATTAGCTTCAACTTTAGTTTAAAATTATGTGAATAAATATTTTGATTTCTACAAATCTTAACATTTAACCATGTTGG
 161 TTTAAAAATATTATTGCTTGCTACTTGGACATAACTAATTTTTCCTTGTGCATTTAATACCTCTGGGCAGAATCCAAATA
 241 CTGGGTTCTCCCGTAGTTCGTCTTTAGTTACTAAGAAAGGGTGTAGGACACATTAGCCTTCTGGAAACAAGTAGAAGCCA
 321 TCACCTGGCCCATGTCCCTACAAACCCATGATTGTCAGGGAGGTGCCAGTTACAGCAGGTGATTCAGCTACTTGAGGTCG
 401 GTAACAGACCTTCCATTCCTCACTGAAGGTGGGGTTTGTGTTTTTGTTTTGCCCTGTTACTCCACTGGTAGTCATCTGGT
 481 GTTTGTACTATAACAACAGCAAGAAAATCTCATTTATCTTTATATACTCTTTGCACCTCCTTTTTTTAGTCGAGATATAA
 561 ATATTTGAGGGGAGAGAAATATCTACAGGTATATATGGAAACAAATAATGTGGTCTGCTTTATAAGATGGCCAGATCTAC
 641 ATTAGGAAAAGTATAAGCCCCCTCCCTAATGGCCGCTGGGGGGTGAGGGCGGTGTGTTGTATGTCTTTGGGTGTTTGTTT
 721 TTTTATAAAGCATATAATAAAATAATCGTGCTACTAATGTAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agAUUGUGG--UGUCAC-ACCAAAc 5'
            |||||::  ||  || |||||| 
Target 5' ctTAACATTTAACCATGTTGGTTTa 3'
 140 - 164 134.00 -10.50
2 
miRNA  3' agaUUGUGGUGUCACACCAAAc 5'
             ||||  |:| |||||| | 
Target 5' ggaAACA-AATAATGTGGTCTg 3'
 597 - 617 130.00 -12.70
3 
miRNA  3' agauuGUGG-UGUCACACCAAAc 5'
               |||: | :||| ||||| 
Target 5' ttcctCACTGAAGGTGGGGTTTg 3'
 416 - 438 129.00 -14.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN27767446 18 COSMIC
COSN30161846 34 COSMIC
COSN16127832 70 COSMIC
COSN26562281 72 COSMIC
COSN31578686 74 COSMIC
COSN510868 79 COSMIC
COSN30537890 110 COSMIC
COSN4779577 194 COSMIC
COSN20582317 381 COSMIC
COSN10012166 539 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751335974 3 dbSNP
rs763998462 5 dbSNP
rs1302341672 6 dbSNP
rs1326522762 13 dbSNP
rs762972531 14 dbSNP
rs200970421 17 dbSNP
rs1170088020 18 dbSNP
rs769156235 21 dbSNP
rs759037260 23 dbSNP
rs766948155 26 dbSNP
rs776036588 29 dbSNP
rs371955197 31 dbSNP
rs1204447961 34 dbSNP
rs1336500426 38 dbSNP
rs1482105412 42 dbSNP
rs1284080595 43 dbSNP
rs761318673 43 dbSNP
rs1196584700 44 dbSNP
rs746676277 49 dbSNP
rs554810351 51 dbSNP
rs536739314 52 dbSNP
rs995359763 53 dbSNP
rs1409996009 54 dbSNP
rs779861998 55 dbSNP
rs1291535815 61 dbSNP
rs1487772249 64 dbSNP
rs575555700 67 dbSNP
rs371827386 74 dbSNP
rs557278713 75 dbSNP
rs538165341 83 dbSNP
rs905507675 86 dbSNP
rs142219759 90 dbSNP
rs148718726 98 dbSNP
rs534007104 105 dbSNP
rs1298737959 112 dbSNP
rs757178008 113 dbSNP
rs146534301 123 dbSNP
rs531340560 123 dbSNP
rs370623964 134 dbSNP
rs750091723 137 dbSNP
rs144308630 141 dbSNP
rs943007940 155 dbSNP
rs1314785774 159 dbSNP
rs764131449 160 dbSNP
rs1039309322 161 dbSNP
rs1227432725 161 dbSNP
rs1230082990 162 dbSNP
rs1252333910 176 dbSNP
rs911216203 176 dbSNP
rs984054405 177 dbSNP
rs1196155183 189 dbSNP
rs1244496719 190 dbSNP
rs1461466609 191 dbSNP
rs1182671331 195 dbSNP
rs1411342318 206 dbSNP
rs1335159343 211 dbSNP
rs944947469 221 dbSNP
rs952719088 222 dbSNP
rs1460427547 225 dbSNP
rs918646258 226 dbSNP
rs1285744903 250 dbSNP
rs1242410101 252 dbSNP
rs759475864 253 dbSNP
rs529746738 259 dbSNP
rs960127663 260 dbSNP
rs1437344760 262 dbSNP
rs1384234188 273 dbSNP
rs1296767244 274 dbSNP
rs368804838 274 dbSNP
rs1035551965 275 dbSNP
rs1307402154 277 dbSNP
rs182707782 279 dbSNP
rs751680899 282 dbSNP
rs1386575721 287 dbSNP
rs983421324 290 dbSNP
rs1486662985 292 dbSNP
rs776534036 294 dbSNP
rs1186842922 303 dbSNP
rs1260840524 303 dbSNP
rs1476796471 305 dbSNP
rs970032481 308 dbSNP
rs1021559030 317 dbSNP
rs1011223706 319 dbSNP
rs1429918767 322 dbSNP
rs950686219 338 dbSNP
rs771890587 339 dbSNP
rs973872949 348 dbSNP
rs1357593625 353 dbSNP
rs962598977 358 dbSNP
rs1289784530 360 dbSNP
rs1361783193 361 dbSNP
rs568781721 367 dbSNP
rs1023875289 369 dbSNP
rs1320096935 374 dbSNP
rs1462169346 390 dbSNP
rs550125314 399 dbSNP
rs766470468 400 dbSNP
rs1318332187 408 dbSNP
rs997299785 409 dbSNP
rs1161813233 417 dbSNP
rs6111748 428 dbSNP
rs901337465 429 dbSNP
rs531965047 442 dbSNP
rs1201317282 445 dbSNP
rs1269463295 456 dbSNP
rs1374117869 458 dbSNP
rs1191079596 461 dbSNP
rs1465827275 462 dbSNP
rs763200506 468 dbSNP
rs1423200244 470 dbSNP
rs1402663646 475 dbSNP
rs1207644577 477 dbSNP
rs1160185665 478 dbSNP
rs1451805234 479 dbSNP
rs1305376611 482 dbSNP
rs1366687155 483 dbSNP
rs1291657231 485 dbSNP
rs1272543487 490 dbSNP
rs1436462084 490 dbSNP
rs565263963 490 dbSNP
rs1355445876 491 dbSNP
rs1223863367 493 dbSNP
rs1305760918 498 dbSNP
rs1351090703 502 dbSNP
rs773353395 517 dbSNP
rs1224374493 524 dbSNP
rs540519922 524 dbSNP
rs911437716 526 dbSNP
rs1219363041 527 dbSNP
rs1490156627 527 dbSNP
rs1245043780 530 dbSNP
rs999197260 533 dbSNP
rs1411271978 534 dbSNP
rs902149576 547 dbSNP
rs138735602 548 dbSNP
rs1048642229 551 dbSNP
rs1011052781 552 dbSNP
rs1366628745 554 dbSNP
rs931283455 555 dbSNP
rs528717075 556 dbSNP
rs1322080720 558 dbSNP
rs768591111 559 dbSNP
rs1491406291 560 dbSNP
rs973208165 561 dbSNP
rs191911856 569 dbSNP
rs928448940 578 dbSNP
rs760678044 579 dbSNP
rs1405085636 580 dbSNP
rs1315465166 583 dbSNP
rs1397693482 593 dbSNP
rs775573928 599 dbSNP
rs1170956708 601 dbSNP
rs979925972 602 dbSNP
rs772097411 606 dbSNP
rs969881688 606 dbSNP
rs1205253178 609 dbSNP
rs1021524020 610 dbSNP
rs990095105 611 dbSNP
rs1237703974 612 dbSNP
rs1456588817 623 dbSNP
rs1185735736 624 dbSNP
rs1386106437 634 dbSNP
rs1472634660 637 dbSNP
rs762228171 637 dbSNP
rs944856516 638 dbSNP
rs1390163069 641 dbSNP
rs1169305519 643 dbSNP
rs1397581153 645 dbSNP
rs188249622 647 dbSNP
rs997668549 648 dbSNP
rs1445489293 649 dbSNP
rs920578915 654 dbSNP
rs1217983153 656 dbSNP
rs139589175 657 dbSNP
rs1017776897 659 dbSNP
rs14885 662 dbSNP
rs1205648775 673 dbSNP
rs1007037066 674 dbSNP
rs970538638 675 dbSNP
rs1442080376 683 dbSNP
rs1185835233 684 dbSNP
rs1244233456 685 dbSNP
rs575781578 690 dbSNP
rs889962847 691 dbSNP
rs1422126945 692 dbSNP
rs1470633345 699 dbSNP
rs777068179 707 dbSNP
rs931587892 708 dbSNP
rs1207142763 711 dbSNP
rs1320012387 718 dbSNP
rs897159440 720 dbSNP
rs1399312343 724 dbSNP
rs1339959455 725 dbSNP
rs966388240 725 dbSNP
rs111911412 727 dbSNP
rs1219857253 730 dbSNP
rs1010696503 732 dbSNP
rs1037067912 734 dbSNP
rs545454309 735 dbSNP
rs1273259844 743 dbSNP
rs1193402301 746 dbSNP
rs779222776 746 dbSNP
rs182670803 747 dbSNP
rs558940088 748 dbSNP
rs1376619355 758 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 27131.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000377759.4 | 3UTR | UUUAAAAAUAUUAUUGCUUGCUACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000377759.4 | 3UTR | UUAAAAAUAUUAUUGCUUGCUACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.624 7.3e-4 -0.337 5.8e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.664 6.7e-3 -0.584 1.8e-2 13 Click to see details
GSE28544 Breast cancer -0.441 1.5e-2 -0.100 3.2e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.305 9.6e-2 -0.102 3.3e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.212 1.2e-1 -0.257 7.8e-2 32 Click to see details
GSE17498 Multiple myeloma 0.183 1.3e-1 0.048 3.8e-1 40 Click to see details
GSE21687 Ependynoma primary tumors -0.12 1.7e-1 -0.101 2.1e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.258 2.1e-1 -0.091 3.9e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.137 2.6e-1 -0.078 3.6e-1 25 Click to see details
GSE38226 Liver fibrosis -0.106 3.2e-1 -0.199 1.9e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.012 4.8e-1 -0.006 4.9e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.012 4.8e-1 -0.006 4.9e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.012 4.8e-1 -0.006 4.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA -0.905 0.05 -0.800 0.1 4 Click to see details
KICH 0.322 0.12 0.296 0.14 15 Click to see details
CHOL -0.385 0.23 -0.486 0.16 6 Click to see details
PRAD -0.111 0.23 -0.031 0.42 46 Click to see details
HNSC 0.182 0.23 0.364 0.07 18 Click to see details
KIRC -0.112 0.24 -0.100 0.26 43 Click to see details
PAAD 0.503 0.25 0.400 0.3 4 Click to see details
ESCA -0.203 0.29 -0.139 0.35 10 Click to see details
LIHC 0.098 0.3 0.196 0.15 30 Click to see details
STAD -0.099 0.33 0.016 0.47 21 Click to see details
KIRP -0.096 0.34 0.036 0.44 21 Click to see details
LUAD -0.244 0.38 0.000 0.5 4 Click to see details
THCA -0.038 0.4 -0.073 0.32 45 Click to see details
BRCA 0.026 0.44 0.012 0.47 42 Click to see details
UCEC -0.033 0.45 -0.085 0.38 16 Click to see details
LUSC 0.004 0.49 0.061 0.37 30 Click to see details
LUSC 0.004 0.49 0.061 0.37 30 Click to see details
LUSC 0.004 0.49 0.061 0.37 30 Click to see details
LUSC 0.004 0.49 0.061 0.37 30 Click to see details
95 hsa-miR-497-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT092955 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 4
MIRT124568 PRRC2B proline rich coiled-coil 2B 2 2
MIRT125196 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 4
MIRT147296 KPNA2 karyopherin subunit alpha 2 2 8
MIRT163999 KIAA1109 KIAA1109 2 4
MIRT252495 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT357969 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT443007 TRIOBP TRIO and F-actin binding protein 2 2
MIRT443524 NETO1 neuropilin and tolloid like 1 2 2
MIRT443573 EVX2 even-skipped homeobox 2 2 2
MIRT443656 BACH1 BTB domain and CNC homolog 1 2 2
MIRT460670 KRT10 keratin 10 2 8
MIRT464761 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT465032 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT465040 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT468667 SEC62 SEC62 homolog, preprotein translocation factor 2 2
MIRT473694 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT477618 EFNA3 ephrin A3 2 2
MIRT480506 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT480592 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT486915 ZNF398 zinc finger protein 398 2 6
MIRT487770 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 16
MIRT493265 MDFIC MyoD family inhibitor domain containing 2 2
MIRT495271 SLC1A2 solute carrier family 1 member 2 2 4
MIRT495309 CHST12 carbohydrate sulfotransferase 12 2 2
MIRT496681 DPP6 dipeptidyl peptidase like 6 2 4
MIRT496891 FOXP1 forkhead box P1 2 2
MIRT497330 IRF4 interferon regulatory factor 4 2 2
MIRT498272 KIAA1644 KIAA1644 2 2
MIRT498634 CHD4 chromodomain helicase DNA binding protein 4 2 10
MIRT500581 USP53 ubiquitin specific peptidase 53 2 2
MIRT500751 TMPPE transmembrane protein with metallophosphoesterase domain 2 6
MIRT509668 ZNF354B zinc finger protein 354B 2 10
MIRT510919 PSMA2 proteasome subunit alpha 2 2 4
MIRT519118 CEP76 centrosomal protein 76 2 2
MIRT526193 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 2 2
MIRT526746 HLA-DOB major histocompatibility complex, class II, DO beta 2 2
MIRT527270 FBLN2 fibulin 2 2 2
MIRT528198 PLEKHM2 pleckstrin homology and RUN domain containing M2 2 2
MIRT528330 TBC1D22B TBC1 domain family member 22B 2 2
MIRT530346 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT533627 TMX3 thioredoxin related transmembrane protein 3 2 2
MIRT533738 TMEM200C transmembrane protein 200C 2 2
MIRT533779 TMEM133 transmembrane protein 133 2 2
MIRT534317 SKIDA1 SKI/DACH domain containing 1 2 2
MIRT538438 COG5 component of oligomeric golgi complex 5 2 2
MIRT539156 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT539474 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT539620 SHISA9 shisa family member 9 2 2
MIRT539650 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT540346 OPHN1 oligophrenin 1 2 2
MIRT540412 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 2
MIRT541200 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT541395 CDC27 cell division cycle 27 2 2
MIRT546443 SNX5 sorting nexin 5 2 2
MIRT547369 MSI2 musashi RNA binding protein 2 2 2
MIRT553288 TSPAN3 tetraspanin 3 2 2
MIRT554402 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT557822 FOXN2 forkhead box N2 2 2
MIRT568530 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT569508 THYN1 thymocyte nuclear protein 1 2 2
MIRT570707 FAM69A family with sequence similarity 69 member A 2 2
MIRT608376 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT608483 NKTR natural killer cell triggering receptor 2 6
MIRT613533 TRA2B transformer 2 beta homolog 2 2
MIRT616601 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT618166 DUSP18 dual specificity phosphatase 18 2 2
MIRT632059 CEP135 centrosomal protein 135 2 2
MIRT647379 ZDHHC23 zinc finger DHHC-type containing 23 2 2
MIRT648366 POTED POTE ankyrin domain family member D 2 2
MIRT651075 ZNF518B zinc finger protein 518B 2 4
MIRT653618 SLC30A4 solute carrier family 30 member 4 2 2
MIRT653636 SLC30A1 solute carrier family 30 member 1 2 2
MIRT654895 POU2F1 POU class 2 homeobox 1 2 2
MIRT656232 MFSD6 major facilitator superfamily domain containing 6 2 2
MIRT659880 CAPRIN1 cell cycle associated protein 1 2 2
MIRT660526 ARL4C ADP ribosylation factor like GTPase 4C 2 2
MIRT666286 SLC30A3 solute carrier family 30 member 3 2 2
MIRT686808 SNX2 sorting nexin 2 2 4
MIRT695302 TK1 thymidine kinase 1 2 2
MIRT699737 SERINC3 serine incorporator 3 2 2
MIRT700794 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT712270 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT712617 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT714264 RPL10A ribosomal protein L10a 2 2
MIRT715072 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT715386 TADA3 transcriptional adaptor 3 2 2
MIRT716397 NPAS1 neuronal PAS domain protein 1 2 2
MIRT725328 NFASC neurofascin 2 2
MIRT725503 GANAB glucosidase II alpha subunit 2 2
MIRT732913 IRAK2 interleukin 1 receptor associated kinase 2 3 0
MIRT734890 SMAD3 SMAD family member 3 3 0
MIRT737328 LINC02476 long intergenic non-protein coding RNA 2476 3 0
MIRT737544 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 4 0
MIRT755545 PAK1 p21 (RAC1) activated kinase 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-497 Bufalin NULL 9547215 Quantitative real-time PCR colorectal cancer HCT116 cells 24375248 2014 up-regulated
miR-497 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-497 Ethanol NULL 702 Quantitative real-time PCR CIE10 22141737 2012 up-regulated
miR-497 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-497 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-497 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-497 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-497 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-497 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-497 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-497-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (BT-20, BT-474, BT-549, CAMA-1, HCC1143, HCC1395, HCC1569, HCC1806, HCC-1937, HCC1954, HCC202, HCC38, HCC70, Hs578T, MCF-7, MDA-MB-175VII, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-468, SKBR3, T47D, UACC812, EVSA-T, MPE-600 , SK-BR-
hsa-miR-497-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, PC-9)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-497-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-497-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant tissue
hsa-miR-497-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission