pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4457 |
Genomic Coordinates | chr5: 1309310 - 1309377 |
Description | Homo sapiens miR-4457 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4457 | |||||||||||||||||||||
Sequence | 43| UCACAAGGUAUUGACUGGCGUA |64 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | POGZ | ||||||||||||||||||||
Synonyms | MRD37, WHSUS, ZNF280E, ZNF635, ZNF635m | ||||||||||||||||||||
Description | pogo transposable element derived with ZNF domain | ||||||||||||||||||||
Transcript | NM_015100 | ||||||||||||||||||||
Other Transcripts | NM_145796 , NM_207171 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on POGZ | |||||||||||||||||||||
3'UTR of POGZ (miRNA target sites are highlighted) |
>POGZ|NM_015100|3'UTR 1 GTGTTGGGGTCATGAGGGGGTGTGGAGTGAGGGTGGGAACATGTGAGGGAGGGTAAAGGGGCTTAGGGAAAAGGGGGCAT 81 ACCAGGTGGGGTATTTGGTTTCTATTTTTTAATTTTATACCACCACTCCCCCCTGAAGTTGACTTACACTTCCCTGTGGA 161 TTTGTGGATTAATTAGGAAAACCAATAGTAATCACGTCTGAGCCAAGGAGCTGGCCCATTGGTCATTCACTTCTGCTAAA 241 AACAGGTTTTTGTGACTTTTTTTTTTTTTAAATTTAAATCACTGTGTTTGGTATTTTTCTGACAAAATTAAGAAAAAGAA 321 AAAAAATTATTTGTGGGCAAATGTTAAATTTTTTTGTTTCCCCTTTTACCTCAATTGTATCATAGTACTGGGTTTTTTTG 401 TTTGTTTTATTGTGTGGCCAATGTCTTTGGGCATGATGCTATCTAATCATTGTTAATGTGAGAACATTTCTGAAGATGGG 481 AAAGACAAATTATGTAGCTCACAAACTGGTTTATTATATATATGGATAAAAAACTTTTTTCATTGTGGTCTTAACACTTT 561 TATATAAAAATGAAAATGGAAAAAAAGTCCCACTGAACTCTCTCTTCCTTCTCCTTTTCTTTCCTTCCCTCTCCAGAGAT 641 GTTGGTTTCTACAGCAACCCTAGATATAAAATTGTGGCTTTAAAAATGCATGAAACCACCTTTAATTATCCAGAATGAAT 721 AGATTTGTCTTTTCCTCACCACCTTCCCTCCAAAACATGACATAAACAATATTTTTTGCACTTGTGATCCTTGGCCCCTT 801 TCCCCATTCTCAACACCATCCATCCCTCTGGACAAAGGATCATACAGGTGTTATTAGCAAGCAAGAGATACTGAAGCGAT 881 CAAACAGTTTTAGGGTGGAAGCCATTCCCAGTTTGAGTCTTCATCCTGTAAGCCCCCAGGGGCAGTCCCTGCTTTACTGA 961 ACTTCATCCTGTTAGATGGAGAGCATGCCTGTTTAAGGGATTACTGGTCCTACAGCCAGGAGCTAATTGTTCAAGAAGTG 1041 TTGAACTTTAAAAAGACAAGACCACTTGTTGAAATCCAGCGTGCTCTGTGGCTTTCCCCTATTTCTCTTAATACTTAGGG 1121 AAGAATCTGACAGGAAGAAGCGCACAGGGGTGTGCACAAAGAAAATGACATGAATCTTTATTTTTCACTGCCAGCTTCAA 1201 GGAAAGAAAATTTTTTCTACAATTTGCATGAGGGATTTTTTTAATTGTATGTACTCATGGTTGTAAACCAAAACGTACTG 1281 TACCGTACAGAGAAAAGGAGCAAAAAACCAAGTCTTCTGTTTATCCTGAGGCTTTCCACAATGTTCCCCTCCTGTGAGCC 1361 AAGGAGGCAAACTGCACAAGCTTGTAAATGGTTCGTCTTTAAAATGTACATAAGTGGAACATTTAATAAAATGAGGGGAA 1441 ATGGATTTATAAACTTGTTTTTTTTCTAGGTGACCCTGTTTAATAGGCTTTCACAGACTGGGGAATGCTCAAGATGTGAT 1521 GGGCCTGGTGGTACAGGTGTGACATTTGTTACCACCCATTTCTCCCACCCCACCCTGCTTTTTTGTTTGTTTGTTTTTTC 1601 ATCCCCCAGCACACTATAATATAGTGAACTGGAAAAGTCCCTTCCAGAAACAGCTTGGCCAGCTTTGTGAACCTTTGACA 1681 TCTGAAAACAACCAAGGATCCATCTGGGCTTCTCTTCCCCAGCTTTTTGCCTGATGCCATTTTATTGACAGACAATGGAC 1761 TTTGAAGTCAGCCTTTGCCTTTGAGAAAGTTCAAGAACTATGGTTGGTCACGTCTATCTACAACCTAATCCTACTCTTTG 1841 GTAGTCTCTGCAGCAGCCACAGCCTTAGCAGAGCTGGGGTTCCTGTCTTCTGCACACGATTGACTTTCTTGATGGGTAAT 1921 TTTTTTTAAGATTATACCAACAGTGGATCAGCTGGGTTTTGGCCAGGAAGTTGTCTTTGTGGACTCTGCCTGCATGGCTT 2001 AGTAGTAGAAGGAAATTTTTTTTTGGTTTTGTTTTTTATAATTCAGTTTAATCAATAAACATGTATTTATTGACTGTTAA 2081 AAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 23126.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000392723.1 | 3UTR | UGACAUAAACAAUAUUUUUUGCACUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000392723.1 | 3UTR | ACAUAAACAAUAUUUUUUGCACUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
83 hsa-miR-4457 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT098032 | SOBP | sine oculis binding protein homolog | 2 | 2 | ||||||||
MIRT202580 | PCMTD2 | protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 | 2 | 6 | ||||||||
MIRT247137 | WEE1 | WEE1 G2 checkpoint kinase | 2 | 4 | ||||||||
MIRT349266 | PTBP1 | polypyrimidine tract binding protein 1 | 2 | 2 | ||||||||
MIRT363756 | EIF4EBP1 | eukaryotic translation initiation factor 4E binding protein 1 | 2 | 2 | ||||||||
MIRT443586 | FAM84B | family with sequence similarity 84 member B | 2 | 2 | ||||||||
MIRT452333 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | 2 | 2 | ||||||||
MIRT453864 | ZBTB40 | zinc finger and BTB domain containing 40 | 2 | 4 | ||||||||
MIRT471486 | PDE4D | phosphodiesterase 4D | 2 | 4 | ||||||||
MIRT476290 | GMFB | glia maturation factor beta | 2 | 8 | ||||||||
MIRT479897 | CCDC117 | coiled-coil domain containing 117 | 2 | 4 | ||||||||
MIRT484251 | ANK1 | ankyrin 1 | 2 | 2 | ||||||||
MIRT491473 | TMEM214 | transmembrane protein 214 | 2 | 2 | ||||||||
MIRT493804 | GAN | gigaxonin | 2 | 6 | ||||||||
MIRT499252 | VAV3 | vav guanine nucleotide exchange factor 3 | 2 | 4 | ||||||||
MIRT502271 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | 2 | 4 | ||||||||
MIRT504651 | RPL9 | ribosomal protein L9 | 2 | 6 | ||||||||
MIRT505211 | UBN2 | ubinuclein 2 | 2 | 8 | ||||||||
MIRT508952 | SNRPB | small nuclear ribonucleoprotein polypeptides B and B1 | 2 | 4 | ||||||||
MIRT512691 | POP1 | POP1 homolog, ribonuclease P/MRP subunit | 2 | 2 | ||||||||
MIRT513320 | SCUBE3 | signal peptide, CUB domain and EGF like domain containing 3 | 2 | 2 | ||||||||
MIRT513870 | HOXA5 | homeobox A5 | 2 | 2 | ||||||||
MIRT517342 | ZNF529 | zinc finger protein 529 | 2 | 4 | ||||||||
MIRT518947 | LSG1 | large 60S subunit nuclear export GTPase 1 | 2 | 2 | ||||||||
MIRT520867 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | 2 | 2 | ||||||||
MIRT528325 | GIGYF2 | GRB10 interacting GYF protein 2 | 2 | 2 | ||||||||
MIRT531990 | SLCO1B3 | solute carrier organic anion transporter family member 1B3 | 2 | 2 | ||||||||
MIRT533298 | USP46 | ubiquitin specific peptidase 46 | 2 | 2 | ||||||||
MIRT545257 | TRIM36 | tripartite motif containing 36 | 2 | 4 | ||||||||
MIRT547038 | POGZ | pogo transposable element derived with ZNF domain | 2 | 2 | ||||||||
MIRT556103 | MOAP1 | modulator of apoptosis 1 | 2 | 2 | ||||||||
MIRT558321 | DR1 | down-regulator of transcription 1 | 2 | 2 | ||||||||
MIRT558521 | CSRNP3 | cysteine and serine rich nuclear protein 3 | 2 | 2 | ||||||||
MIRT560906 | TMED10 | transmembrane p24 trafficking protein 10 | 2 | 2 | ||||||||
MIRT568448 | ARPP19 | cAMP regulated phosphoprotein 19 | 2 | 2 | ||||||||
MIRT570586 | OTUD7B | OTU deubiquitinase 7B | 2 | 2 | ||||||||
MIRT572799 | SIGLEC14 | sialic acid binding Ig like lectin 14 | 2 | 2 | ||||||||
MIRT573863 | C9orf78 | chromosome 9 open reading frame 78 | 2 | 2 | ||||||||
MIRT575058 | P2ry1 | purinergic receptor P2Y, G-protein coupled 1 | 2 | 5 | ||||||||
MIRT609931 | SLC38A1 | solute carrier family 38 member 1 | 2 | 4 | ||||||||
MIRT610836 | ZNF585A | zinc finger protein 585A | 2 | 4 | ||||||||
MIRT611474 | P2RY1 | purinergic receptor P2Y1 | 2 | 7 | ||||||||
MIRT613569 | YY2 | YY2 transcription factor | 2 | 2 | ||||||||
MIRT618626 | GREB1 | growth regulation by estrogen in breast cancer 1 | 2 | 2 | ||||||||
MIRT620606 | SAP30 | Sin3A associated protein 30 | 2 | 2 | ||||||||
MIRT621017 | CLSTN3 | calsyntenin 3 | 2 | 4 | ||||||||
MIRT635314 | FAM179A | TOG array regulator of axonemal microtubules 2 | 2 | 2 | ||||||||
MIRT635919 | GLTSCR2 | NOP53 ribosome biogenesis factor | 2 | 2 | ||||||||
MIRT640598 | TM9SF4 | transmembrane 9 superfamily member 4 | 2 | 2 | ||||||||
MIRT641784 | YWHAB | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta | 2 | 4 | ||||||||
MIRT644067 | IQCE | IQ motif containing E | 2 | 2 | ||||||||
MIRT648288 | TRAPPC2L | trafficking protein particle complex 2 like | 2 | 2 | ||||||||
MIRT658085 | FOXR2 | forkhead box R2 | 2 | 2 | ||||||||
MIRT659077 | DEPTOR | DEP domain containing MTOR interacting protein | 2 | 2 | ||||||||
MIRT665307 | ZBTB37 | zinc finger and BTB domain containing 37 | 2 | 2 | ||||||||
MIRT665975 | SYTL4 | synaptotagmin like 4 | 2 | 2 | ||||||||
MIRT666302 | SLC25A25 | solute carrier family 25 member 25 | 2 | 2 | ||||||||
MIRT674906 | RASSF9 | Ras association domain family member 9 | 2 | 2 | ||||||||
MIRT680086 | THAP1 | THAP domain containing 1 | 2 | 2 | ||||||||
MIRT681488 | DIP2A | disco interacting protein 2 homolog A | 2 | 2 | ||||||||
MIRT691244 | DFNB59 | pejvakin | 2 | 2 | ||||||||
MIRT692362 | AGTRAP | angiotensin II receptor associated protein | 2 | 2 | ||||||||
MIRT693035 | MB21D1 | Mab-21 domain containing 1 | 2 | 2 | ||||||||
MIRT693837 | STAT5A | signal transducer and activator of transcription 5A | 2 | 2 | ||||||||
MIRT694479 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | 2 | 2 | ||||||||
MIRT696070 | ZNF264 | zinc finger protein 264 | 2 | 2 | ||||||||
MIRT696578 | TTC21B | tetratricopeptide repeat domain 21B | 2 | 2 | ||||||||
MIRT696760 | MTFMT | mitochondrial methionyl-tRNA formyltransferase | 2 | 2 | ||||||||
MIRT697307 | ZNF652 | zinc finger protein 652 | 2 | 2 | ||||||||
MIRT700152 | RNF115 | ring finger protein 115 | 2 | 2 | ||||||||
MIRT701056 | PARP2 | poly(ADP-ribose) polymerase 2 | 2 | 2 | ||||||||
MIRT701198 | OTUD3 | OTU deubiquitinase 3 | 2 | 2 | ||||||||
MIRT701335 | NSD1 | nuclear receptor binding SET domain protein 1 | 2 | 2 | ||||||||
MIRT702656 | ITGA3 | integrin subunit alpha 3 | 2 | 2 | ||||||||
MIRT703618 | FBXO45 | F-box protein 45 | 2 | 2 | ||||||||
MIRT704673 | CHTOP | chromatin target of PRMT1 | 2 | 2 | ||||||||
MIRT708894 | ZNF780A | zinc finger protein 780A | 2 | 2 | ||||||||
MIRT711620 | DGKH | diacylglycerol kinase eta | 2 | 2 | ||||||||
MIRT713745 | TMEM81 | transmembrane protein 81 | 2 | 2 | ||||||||
MIRT719712 | CD101 | CD101 molecule | 2 | 2 | ||||||||
MIRT720294 | DLGAP3 | DLG associated protein 3 | 2 | 2 | ||||||||
MIRT722606 | CCDC152 | coiled-coil domain containing 152 | 2 | 2 | ||||||||
MIRT724566 | ACSBG1 | acyl-CoA synthetase bubblegum family member 1 | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|