pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4282 |
Genomic Coordinates | chr6: 72967687 - 72967753 |
Description | Homo sapiens miR-4282 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4282 | ||||||||||||
Sequence | 40| UAAAAUUUGCAUCCAGGA |57 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | SOLiD | DRVs in miRNA |
|
||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PANK3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | pantothenate kinase 3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_024594 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on PANK3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of PANK3 (miRNA target sites are highlighted) |
>PANK3|NM_024594|3'UTR 1 AGCATCAGGTCTCTCTCTCTGCTAATAAATGTCATCCAAGAGGAACTAAAACCAGAGGCATTATTACTGCATTGTTTGTC 81 ACTGGGAACCAAAGGATAAAAGAGTAGCATAAGCTGCTGAATGTTGCCATATTAAAGGAGAGAACTTGGTAACGTGAAGT 161 ATTTCTCATTGAAATGCTTTCCCTTTTGTATATAGCCAGTGTTAAATCCTTAAATGCAATACAGCCTCTGATTATTGAGC 241 TTCCTCTTAAAAAGATTTTTTTATTTTATGTAGCCAACATTGCAGTACTGTATGCTCAAACACAAATCTTAAAGTATCGG 321 AACTGTTTAGCTTATGAAAATAATCGACTCTGAATATTTGTTACAAGTCTGTTTTATGTGTTTTGATTACTAGTGAGCAG 401 AAAATAACATACCCTGTATTCAAAATTACTGAAATGGCAATCAAAGATGATCATTTTTATGTGATTTTAGAAATGTTAAG 481 GCAATACTACTAATTATTGTAGGTTTTTTTAACGTATCACCCAAAGCATGTATGTGATCTTTCCCCATTAGTATCTTTTT 561 CTCAAATGCCATAATTAACTGAAATACTATTATTAAATTTTCATGAGAATTCTAAAATGAATCCTGGGAAATGCACGTTT 641 GGTGATGTTGCACTTTCTGTATTTTACAGGAATTAGTCAATACATGTTGAAATGTTTAACATTTTAAGATTGGAGGCTTA 721 ATTACTGGGAGTCTGTCTAATGAAGTCCTGGGACTATTGTAATGGAATATGATTTGAGTTCACTGTGCTCTTTTTGTTTG 801 TTTGTTTTGGTCATATATACATTCAGAACTTTTATTTTAAAACAACCACAATAACATTAATAATAGAAAATTCATCTGTA 881 AATATTCACAGTCTAGTCACTGAAAAATGGGAAAACCTCTACCATGCCTTATTATTACCCTTTGCTGTTTGAGGAGCCAG 961 AAATAGAGGTGCAGTTAGAGGACGGTCACTTTTTCCAACAAAACCCACTCCATAGCCATGTGGATTTTTATCCAAAGGCT 1041 CAACAACCAGAGGGAATGGTGAGACCTGATAACTAAAATACTGTTATTGGCAAGGGTTTGAAATGTGTAAGAACCTAGGA 1121 GGGAAAGGAAGATTGAGCAACATAGGAAAAGGGGAAGAGAGGCTGAGTGTCACCAAGGTCCAAACTCCATTTATAAAAAT 1201 ACTGCAAAACCAGGAGTTGATGGTAGAAATGCATATGATCCATGGCAGGAGTAAATCTCTCCACCTCCTCTAACTCTCTG 1281 AAAACTCTAGAGTTGGAGCAAGTCTTCCATTTGCTTCTTATCCCCTTAAAAGAATGCCTTCCACTTCCCAACAGCCCCCA 1361 TCAAGGGACCCCAAGAGGCCACCATGCTCTTATCTCGCACTTTCTTTCCTATTCCCCTTGCCTGAATCTGGAGTGGGGTT 1441 GAGCCCTCTGCCTTCAACCTTAAGATTTAGGAAGTTCTTTCCCCAACTGTCTAACTTGGAAAGGTAGATGAGTCTGAATT 1521 TTGAAGTAACGAATGCAAATTCCACTCAGCAGAGGCAATGTTATTTATGTACATAGGGATAGTGGAATGAGTTTTAATAG 1601 ATTCTGTCCAAAAGGGGTTTGTTCCTCTTATTTCCTCTATGTAGGAAGTTGTGTCTTAGGCAACTTTATCAGTATCAATG 1681 GAAAAATGATAGGCACTACAATGAAATGGCAGGATGCCAATATGAGATATTTCAGGAATAATAAGAAATACAGTTTGTTT 1761 GTATAAAATAAACTATCTCAAGAAAGTTTTCAACGACAGTGATAGTGTTCATTTGTAAGAGAGAGTTCTAGAACTTCGAT 1841 GTCCAGTGCAGTAGCCACTACCCATATGTAGCTGTTGAGCATTTGAAATATGGTTAGTCCAAATTGAGATGTGCTCTAAA 1921 GGACAATAAAAGGTTAAATATCTCCTAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 79646.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000239231.6 | 3UTR | CCAUAAAUUUUAUUCAUAAUAAACUAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000239231.6 | 3UTR | AUGUGCCAUAAAUUUUAUUCAUAAUAAACUAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000239231.6 | 3UTR | CCAUAAAUUUUAUUCAUAAUAAACUAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
280 hsa-miR-4282 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT057628 | LCOR | ligand dependent nuclear receptor corepressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT060732 | RPS3 | ribosomal protein S3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT063371 | ETNK1 | ethanolamine kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT066257 | LRIG3 | leucine rich repeats and immunoglobulin like domains 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT070774 | HIF1A | hypoxia inducible factor 1 alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT070871 | EIF2S1 | eukaryotic translation initiation factor 2 subunit alpha | ![]() |
![]() |
2 | 4 | ||||||
MIRT078056 | PCTP | phosphatidylcholine transfer protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT078408 | DCAF7 | DDB1 and CUL4 associated factor 7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT084059 | PPP1R3D | protein phosphatase 1 regulatory subunit 3D | ![]() |
![]() |
2 | 2 | ||||||
MIRT093537 | GALNT7 | polypeptide N-acetylgalactosaminyltransferase 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT096072 | SFXN1 | sideroflexin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT098316 | REV3L | REV3 like, DNA directed polymerase zeta catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT100493 | UHRF1BP1 | UHRF1 binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT102254 | HBP1 | HMG-box transcription factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT105318 | VPS37A | VPS37A, ESCRT-I subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT114143 | MZT1 | mitotic spindle organizing protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT114873 | DICER1 | dicer 1, ribonuclease III | ![]() |
![]() |
2 | 2 | ||||||
MIRT134683 | PNRC2 | proline rich nuclear receptor coactivator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT137640 | RCOR1 | REST corepressor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT155449 | CCNT2 | cyclin T2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT165656 | DCTN4 | dynactin subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT177570 | CSTF2T | cleavage stimulation factor subunit 2 tau variant | ![]() |
![]() |
2 | 4 | ||||||
MIRT188514 | E2F7 | E2F transcription factor 7 | ![]() |
![]() |
2 | 10 | ||||||
MIRT193019 | TMOD3 | tropomodulin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT195823 | GADD45A | growth arrest and DNA damage inducible alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT195885 | DEPDC1 | DEP domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT206029 | NUP50 | nucleoporin 50 | ![]() |
![]() |
2 | 6 | ||||||
MIRT212148 | CLCN3 | chloride voltage-gated channel 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT213999 | DCP2 | decapping mRNA 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT214650 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | ![]() |
![]() |
2 | 2 | ||||||
MIRT221568 | CBX3 | chromobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT224544 | ZNF623 | zinc finger protein 623 | ![]() |
![]() |
2 | 2 | ||||||
MIRT227654 | SET | SET nuclear proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT229992 | CHIC1 | cysteine rich hydrophobic domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT238968 | QKI | QKI, KH domain containing RNA binding | ![]() |
![]() |
2 | 2 | ||||||
MIRT239825 | ACTB | actin beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT241084 | ZXDA | zinc finger, X-linked, duplicated A | ![]() |
![]() |
2 | 4 | ||||||
MIRT244852 | ZBTB5 | zinc finger and BTB domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT264534 | TARDBP | TAR DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT271438 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT271597 | ENAH | ENAH, actin regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT294332 | ZNF264 | zinc finger protein 264 | ![]() |
![]() |
2 | 2 | ||||||
MIRT296341 | PARD6B | par-6 family cell polarity regulator beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT301715 | TEF | TEF, PAR bZIP transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT308549 | ZNF654 | zinc finger protein 654 | ![]() |
![]() |
2 | 2 | ||||||
MIRT313866 | DEPDC1B | DEP domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT315529 | MARCKS | myristoylated alanine rich protein kinase C substrate | ![]() |
![]() |
2 | 2 | ||||||
MIRT321066 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT343777 | NUTF2 | nuclear transport factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT359109 | MAP1B | microtubule associated protein 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT397393 | GOLGA3 | golgin A3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT400822 | CPEB2 | cytoplasmic polyadenylation element binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442171 | DSEL | dermatan sulfate epimerase-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT442777 | JAG1 | jagged 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442862 | SCARF1 | scavenger receptor class F member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT442919 | PCBD2 | pterin-4 alpha-carbinolamine dehydratase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444567 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT444718 | CMSS1 | cms1 ribosomal small subunit homolog (yeast) | ![]() |
![]() |
2 | 2 | ||||||
MIRT445018 | RBMS3 | RNA binding motif single stranded interacting protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445853 | LRRC1 | leucine rich repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446242 | HELZ | helicase with zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT446542 | GOLGA8B | golgin A8 family member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT446643 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446948 | ZMAT3 | zinc finger matrin-type 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT447061 | KCNAB1 | potassium voltage-gated channel subfamily A member regulatory beta subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447327 | ZSCAN21 | zinc finger and SCAN domain containing 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447995 | CDX1 | caudal type homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448543 | RHEBP1 | RHEB pseudogene 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT448752 | HINT1 | histidine triad nucleotide binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448772 | GOLGA8A | golgin A8 family member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT449342 | WDR26 | WD repeat domain 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450011 | SLC16A6 | solute carrier family 16 member 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT450229 | PCNX | pecanex homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450340 | MRPL17 | mitochondrial ribosomal protein L17 | ![]() |
![]() |
2 | 4 | ||||||
MIRT450381 | MSI2 | musashi RNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450759 | PGGT1B | protein geranylgeranyltransferase type I subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT450809 | NRCAM | neuronal cell adhesion molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT450947 | ATAD2 | ATPase family, AAA domain containing 2 |