pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3152 |
Genomic Coordinates | chr9: 18573306 - 18573379 |
Description | Homo sapiens miR-3152 stem-loop |
Comment | Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method . |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3152-5p | ||||||||||||||||||||||||
Sequence | 11| AUUGCCUCUGUUCUAACACAAG |32 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | GOLGA7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | GCP16, GOLGA3AP1, GOLGA7A, HSPC041 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | golgin A7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_001174124 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_001002296 , NM_016099 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on GOLGA7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of GOLGA7 (miRNA target sites are highlighted) |
>GOLGA7|NM_001174124|3'UTR 1 GCAGTGGAAGATAAACCGAAGAATTAAAGATCCCACTTCCAGCCGGGCCCCTCATGTATCCACTGGCCGACCGCAGAGTG 81 TCCCTACCTCCTCTCCAGAGCATCATTCCTTTCTATCTGCTGCCAGAGCCACGGTGCCATTTACTCCAAGGACTCACTTT 161 CTAAAATTCCACACCTGGAGTGACCTCTAGTCGCTCAGCATCCACTTTGTGTCTCCAAATTGTGTAGGACTCTGTAATCT 241 TTTGATTAGTTTCTGAGAAAACACAATGAAGCACTTCACTTTTTTTTATTCAAAGCCATTTAATAAAACACAGTTGGTCA 321 GCCCAGTGCAAAGCTTGTTATCTGCCACCAGTACATACCATTGGTTCTCTTCATTCCTTGGGCCAGCTTCTCAGGTGGCT 401 TTAGACCTCAACAAGCCGTATCTTCACCAGTGTTCTATCTTGTTCCCCTAAATTAATAAAATGTTTTTCTCCAGGATTTT 481 GGTGAGGGTTGGCTGTGGCTGTCGTTTTGCACCTCCCAGATTTCAAAGAATTACTGGTTTTACCATGACTCAAATCTTAA 561 GATCTGTTTCTACTATTCAGTTCCTCAAACTGAAGCTTATTGAAAAAAAAATGTATAATGTTATTTGTTTTATTATAGCA 641 ATTATGCCTAATTAAAGCAGTATTTAATGCAATTTCCAGTTATTTCTTTGGAGAATTTTATGTCATTGTTCCATTACCTT 721 GAATGTTGGAAAGATATGATACGTGCTGCTTGTTCATCACAAAAATCAGTAAGCACAATAAAGTGGATGCCAAACCATCA 801 GACACATAAATGTTCCCGCTGTGTCCCTGGATATGGAATAAGCAGGTATAAAAAATATTTTAATTATAGTTTTGTTATAA 881 ATATAACTTATGAGAAAAAAATTTGATAGGAATAATACTGTATATTACTAATTTTTAACTATCCCTAAGGCAAACCTTAT 961 GACCCACAGAATTTTCTCATATACAGTATTCAGTGCACAGAAATCTTATGATTGGCTCAAGTACAGTAAGTTACTTCTCA 1041 GTAAAACTCTCAAGTCTGAGTCCATATTTGTAGCTCTGCTTTTGGCTGTACGTTCCTAGGATCGGGGCTGCTTATGCCTT 1121 TCGTTTATCCTTGGGGTTTGAGAGCGCTGTATTTGGGAGAGAGTTTAAAAATACATTAGGAGAGAGAAACCATTAAAAGT 1201 TTCACTGTCAGATATATTGTAGGTGCTAATACTGGATTTCGTCTCAGATTTAATTTCTTTTATGGGTCTGTTAGTCATTC 1281 AACAAATCCCATAAGTATGTGTTAATATTTTAATTGTGTAAAACTCATTTGTTACTTTACAGCCTGTAATAGTGTGTCTG 1361 CATTTTCAACCTGTTGCAATAACTTTGCTGAAATATTAACACATTAATAAAACTTTTCTTAAACAAAAAAAAAAAAAAAA 1441 A Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 51125.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000405786.2 | 3UTR | UAUAUUACUAAUUUUUAACUAUCCCUAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
75 hsa-miR-3152-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT092535 | KBTBD8 | kelch repeat and BTB domain containing 8 | 2 | 6 | ||||||||
MIRT461731 | NDUFA2 | NADH:ubiquinone oxidoreductase subunit A2 | 2 | 2 | ||||||||
MIRT468456 | SET | SET nuclear proto-oncogene | 2 | 2 | ||||||||
MIRT482192 | AHR | aryl hydrocarbon receptor | 2 | 2 | ||||||||
MIRT507923 | BZW1 | basic leucine zipper and W2 domains 1 | 2 | 4 | ||||||||
MIRT512208 | C18orf25 | chromosome 18 open reading frame 25 | 2 | 6 | ||||||||
MIRT526238 | STARD4 | StAR related lipid transfer domain containing 4 | 2 | 2 | ||||||||
MIRT536131 | MAPK14 | mitogen-activated protein kinase 14 | 2 | 2 | ||||||||
MIRT536280 | LIMA1 | LIM domain and actin binding 1 | 2 | 2 | ||||||||
MIRT544251 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | 2 | 2 | ||||||||
MIRT548054 | GOLGA7 | golgin A7 | 2 | 2 | ||||||||
MIRT563443 | ISCA1 | iron-sulfur cluster assembly 1 | 2 | 2 | ||||||||
MIRT565643 | SIX4 | SIX homeobox 4 | 2 | 2 | ||||||||
MIRT614870 | PDE12 | phosphodiesterase 12 | 2 | 2 | ||||||||
MIRT614923 | MARCH6 | membrane associated ring-CH-type finger 6 | 2 | 2 | ||||||||
MIRT615793 | FAM124A | family with sequence similarity 124 member A | 2 | 2 | ||||||||
MIRT618557 | VLDLR | very low density lipoprotein receptor | 2 | 2 | ||||||||
MIRT622147 | SORBS2 | sorbin and SH3 domain containing 2 | 2 | 2 | ||||||||
MIRT622390 | RSBN1 | round spermatid basic protein 1 | 2 | 2 | ||||||||
MIRT624185 | DDX19B | DEAD-box helicase 19B | 2 | 2 | ||||||||
MIRT624448 | CALCOCO2 | calcium binding and coiled-coil domain 2 | 2 | 2 | ||||||||
MIRT625340 | TAPBP | TAP binding protein | 2 | 2 | ||||||||
MIRT625370 | IRGQ | immunity related GTPase Q | 2 | 2 | ||||||||
MIRT627276 | WSB1 | WD repeat and SOCS box containing 1 | 2 | 2 | ||||||||
MIRT627746 | RAD54L2 | RAD54 like 2 | 2 | 2 | ||||||||
MIRT629578 | RFC2 | replication factor C subunit 2 | 2 | 4 | ||||||||
MIRT630537 | LGALS8 | galectin 8 | 2 | 4 | ||||||||
MIRT630559 | C3orf36 | chromosome 3 open reading frame 36 | 2 | 4 | ||||||||
MIRT630568 | SOWAHA | sosondowah ankyrin repeat domain family member A | 2 | 4 | ||||||||
MIRT630763 | MSANTD3 | Myb/SANT DNA binding domain containing 3 | 2 | 2 | ||||||||
MIRT635424 | LRP10 | LDL receptor related protein 10 | 2 | 2 | ||||||||
MIRT636011 | GNPNAT1 | glucosamine-phosphate N-acetyltransferase 1 | 2 | 2 | ||||||||
MIRT636337 | PHAX | phosphorylated adaptor for RNA export | 2 | 2 | ||||||||
MIRT638413 | POU3F2 | POU class 3 homeobox 2 | 2 | 2 | ||||||||
MIRT639358 | INIP | INTS3 and NABP interacting protein | 2 | 2 | ||||||||
MIRT642124 | DYRK1A | dual specificity tyrosine phosphorylation regulated kinase 1A | 2 | 4 | ||||||||
MIRT642828 | KIAA0319 | KIAA0319 | 2 | 2 | ||||||||
MIRT644017 | NUCB1 | nucleobindin 1 | 2 | 2 | ||||||||
MIRT644038 | WWC2 | WW and C2 domain containing 2 | 2 | 2 | ||||||||
MIRT644153 | GIN1 | gypsy retrotransposon integrase 1 | 2 | 2 | ||||||||
MIRT644649 | SNX9 | sorting nexin 9 | 2 | 2 | ||||||||
MIRT645798 | OMA1 | OMA1 zinc metallopeptidase | 2 | 2 | ||||||||
MIRT647633 | FAIM2 | Fas apoptotic inhibitory molecule 2 | 2 | 2 | ||||||||
MIRT648528 | KIAA1143 | KIAA1143 | 2 | 2 | ||||||||
MIRT648851 | PDLIM3 | PDZ and LIM domain 3 | 2 | 2 | ||||||||
MIRT648880 | TUBGCP5 | tubulin gamma complex associated protein 5 | 2 | 2 | ||||||||
MIRT650777 | TNFRSF10A | TNF receptor superfamily member 10a | 2 | 2 | ||||||||
MIRT654200 | RNF19B | ring finger protein 19B | 2 | 2 | ||||||||
MIRT654508 | RAB5B | RAB5B, member RAS oncogene family | 2 | 2 | ||||||||
MIRT655249 | PEX26 | peroxisomal biogenesis factor 26 | 2 | 2 | ||||||||
MIRT656089 | MTA3 | metastasis associated 1 family member 3 | 2 | 2 | ||||||||
MIRT656599 | LRRC55 | leucine rich repeat containing 55 | 2 | 2 | ||||||||
MIRT659194 | CYBB | cytochrome b-245 beta chain | 2 | 2 | ||||||||
MIRT660000 | C1orf115 | chromosome 1 open reading frame 115 | 2 | 4 | ||||||||
MIRT661715 | KLF8 | Kruppel like factor 8 | 2 | 2 | ||||||||
MIRT661813 | PRPSAP1 | phosphoribosyl pyrophosphate synthetase associated protein 1 | 2 | 2 | ||||||||
MIRT668360 | FGD4 | FYVE, RhoGEF and PH domain containing 4 | 2 | 2 | ||||||||
MIRT679734 | CABP4 | calcium binding protein 4 | 2 | 2 | ||||||||
MIRT708616 | NUDT18 | nudix hydrolase 18 | 2 | 2 | ||||||||
MIRT709034 | TROVE2 | TROVE domain family member 2 | 2 | 2 | ||||||||
MIRT709573 | DMGDH | dimethylglycine dehydrogenase | 2 | 2 | ||||||||
MIRT709665 | AJAP1 | adherens junctions associated protein 1 | 2 | 2 | ||||||||
MIRT709874 | TRAF1 | TNF receptor associated factor 1 | 2 | 2 | ||||||||
MIRT710821 | NLRP12 | NLR family pyrin domain containing 12 | 2 | 2 | ||||||||
MIRT710883 | PARL | presenilin associated rhomboid like | 2 | 2 | ||||||||
MIRT711547 | LCAT | lecithin-cholesterol acyltransferase | 2 | 2 | ||||||||
MIRT712017 | STX1B | syntaxin 1B | 2 | 2 | ||||||||
MIRT713058 | BLVRA | biliverdin reductase A | 2 | 2 | ||||||||
MIRT713129 | THRB | thyroid hormone receptor beta | 2 | 2 | ||||||||
MIRT713878 | MOB3A | MOB kinase activator 3A | 2 | 2 | ||||||||
MIRT714154 | NXPH3 | neurexophilin 3 | 2 | 2 | ||||||||
MIRT719755 | FLYWCH1 | FLYWCH-type zinc finger 1 | 2 | 2 | ||||||||
MIRT720213 | KCNK1 | potassium two pore domain channel subfamily K member 1 | 2 | 2 | ||||||||
MIRT722728 | BRMS1 | breast cancer metastasis suppressor 1 | 2 | 2 | ||||||||
MIRT725652 | ABI2 | abl interactor 2 | 2 | 2 |