pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-758 |
Genomic Coordinates | chr14: 101026020 - 101026107 |
Synonyms | MIRN758, hsa-mir-758, MIR758 |
Description | Homo sapiens miR-758 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-758-5p | |||||||||||||||||||||||||||||||||||||||||||||
Sequence | 15| GAUGGUUGACCAGAGAGCACAC |36 | |||||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||||||||||||
Experiments | SOLiD | |||||||||||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | FOXA1 | ||||||||||||||||||||
Synonyms | HNF3A, TCF3A | ||||||||||||||||||||
Description | forkhead box A1 | ||||||||||||||||||||
Transcript | NM_004496 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on FOXA1 | |||||||||||||||||||||
3'UTR of FOXA1 (miRNA target sites are highlighted) |
>FOXA1|NM_004496|3'UTR 1 CTCCCGGGACTGGGGGGTTTGTCTGGCATAGCCATGCTGGTAGCAAGAGAGAAAAAATCAACAGCAAACAAAACCACACA 81 AACCAAACCGTCAACAGCATAATAAAATCCCAACAACTATTTTTATTTCATTTTTCATGCACAACCTTTCCCCCAGTGCA 161 AAAGACTGTTACTTTATTATTGTATTCAAAATTCATTGTGTATATTACTACAAAGACAACCCCAAACCAATTTTTTTCCT 241 GCGAAGTTTAATGATCCACAAGTGTATATATGAAATTCTCCTCCTTCCTTGCCCCCCTCTCTTTCTTCCCTCTTTCCCCT 321 CCAGACATTCTAGTTTGTGGAGGGTTATTTAAAAAAACAAAAAAGGAAGATGGTCAAGTTTGTAAAATATTTGTTTGTGC 401 TTTTTCCCCCTCCTTACCTGACCCCCTACGAGTTTACAGGTCTGTGGCAATACTCTTAACCATAAGAATTGAAATGGTGA 481 AGAAACAAGTATACACTAGAGGCTCTTAAAAGTATTGAAAGACAATACTGCTGTTATATAGCAAGACATAAACAGATTAT 561 AAACATCAGAGCCATTTGCTTCTCAGTTTACATTTCTGATACATGCAGATAGCAGATGTCTTTAAATGAAATACATGTAT 641 ATTGTGTATGGACTTAATTATGCACATGCTCAGATGTGTAGACATCCTCCGTATATTTACATAACATATAGAGGTAATAG 721 ATAGGTGATATACATGATACATTCTCAAGAGTTGCTTGACCGAAAGTTACAAGGACCCCAACCCCTTTGTCCTCTCTACC 801 CACAGATGGCCCTGGGAATCAATTCCTCAGGAATTGCCCTCAAGAACTCTGCTTCTTGCTTTGCAGAGTGCCATGGTCAT 881 GTCATTCTGAGGTCACATAACACATAAAATTAGTTTCTATGAGTGTATACCATTTAAAGAATTTTTTTTTCAGTAAAAGG 961 GAATATTACAATGTTGGAGGAGAGATAAGTTATAGGGAGCTGGATTTCAAAACGTGGTCCAAGATTCAAAAATCCTATTG 1041 ATAGTGGCCATTTTAATCATTGCCATCGTGTGCTTGTTTCATCCAGTGTTATGCACTTTCCACAGTTGGACATGGTGTTA 1121 GTATAGCCAGACGGGTTTCATTATTATTTCTCTTTGCTTTCTCAATGTTAATTTATTGCATGGTTTATTCTTTTTCTTTA 1201 CAGCTGAAATTGCTTTAAATGATGGTTAAAATTACAAATTAAATTGTTAATTTTTATCAATGTGATTGTAATTAAAAATA 1281 TTTTGATTTAAATAACAAAAATAATACCAGATTTTAAGCCGTGGAAAATGTTCTTGATCATTTGCAGTTAAGGACTTTAA 1361 ATAAATCAAATGTTAACAAAAGAGCATTTCTGTTATTTTTTTTCACTTAACTAAATCCGAAGTGAATATTTCTGAATACG 1441 ATATTTTTCAAATTCTAGAACTGAATATAAATGACAAAAATGAAAATAAAATTGTTTTGTCTGTTGTTATAATGAATGTG 1521 TAGCTAGTAAAAAGGAGTGAAAGAAATTCAAGTAAAGTGTATAAGTTGATTTAATATTCCAAGAGTTGAGATTTTTAAGA 1601 TTCTTTATTCCCAGTGATGTTTACTTCATTTTTTTTTTTTTTTTTGACACCGGCTTAAGCCTTCTGTGTTTCCTTTGAGC 1681 CTTTTCACTACAAAATCAAATATTAATTTAACTACCTTTCCTCCTTCCCCAATGTATCACTTTTCTTTATCTGAGAATTC 1761 TTCCAATGAAAATAAAATATCAGCTGTGGCTGATAGAATTAAGTTGTGTCCAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 3169.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000250448.2 | 3UTR | AGUUUACAGGUCUGUGGCAAUACUCUUAACCAUAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000250448.2 | 3UTR | AGGUCUGUGGCAAUACUCUUAACCAUAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
62 hsa-miR-758-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT085323 | MORC3 | MORC family CW-type zinc finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT089441 | STAMBP | STAM binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT089456 | TET3 | tet methylcytosine dioxygenase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT111856 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT184933 | ZNF268 | zinc finger protein 268 | ![]() |
![]() |
2 | 2 | ||||||
MIRT215288 | CREBRF | CREB3 regulatory factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT237300 | LPP | LIM domain containing preferred translocation partner in lipoma | ![]() |
![]() |
2 | 2 | ||||||
MIRT238446 | MYO10 | myosin X | ![]() |
![]() |
2 | 4 | ||||||
MIRT273827 | RPL41 | ribosomal protein L41 | ![]() |
![]() |
2 | 2 | ||||||
MIRT282703 | HOOK1 | hook microtubule tethering protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT347970 | ZNF850 | zinc finger protein 850 | ![]() |
![]() |
2 | 2 | ||||||
MIRT371076 | KLF3 | Kruppel like factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464339 | USP6NL | USP6 N-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT470034 | PTP4A1 | protein tyrosine phosphatase type IVA, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477506 | ELL2 | elongation factor for RNA polymerase II 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482886 | CACNA2D3 | calcium voltage-gated channel auxiliary subunit alpha2delta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492606 | POLR3E | RNA polymerase III subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT502294 | GNG12 | G protein subunit gamma 12 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507600 | DCTN4 | dynactin subunit 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510728 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT514065 | KCNJ6 | potassium voltage-gated channel subfamily J member 6 | ![]() |
![]() |
2 | 8 | ||||||
MIRT519718 | ZNF512B | zinc finger protein 512B | ![]() |
![]() |
2 | 4 | ||||||
MIRT520890 | STRN | striatin | ![]() |
![]() |
2 | 2 | ||||||
MIRT521760 | PPIL1 | peptidylprolyl isomerase like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT526874 | ERCC8 | ERCC excision repair 8, CSA ubiquitin ligase complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT530232 | WSB2 | WD repeat and SOCS box containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT532003 | ACTR2 | ARP2 actin related protein 2 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT533371 | UBE2D4 | ubiquitin conjugating enzyme E2 D4 (putative) | ![]() |
![]() |
2 | 4 | ||||||
MIRT547106 | PIGW | phosphatidylinositol glycan anchor biosynthesis class W | ![]() |
![]() |
2 | 2 | ||||||
MIRT548189 | FOXA1 | forkhead box A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552935 | VKORC1L1 | vitamin K epoxide reductase complex subunit 1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560085 | ZNF195 | zinc finger protein 195 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561726 | PPP2CA | protein phosphatase 2 catalytic subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT562713 | ZNF415 | zinc finger protein 415 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562761 | ZNF846 | zinc finger protein 846 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564159 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565673 | SETD5 | SET domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565718 | SESN3 | sestrin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566026 | RFX1 | regulatory factor X1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569048 | ZNF655 | zinc finger protein 655 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570367 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570410 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT570443 | TMEM189 | transmembrane protein 189 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571738 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575042 | Tpgs2 | tubulin polyglutamylase complex subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT614330 | ZDHHC22 | zinc finger DHHC-type containing 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617629 | RAB3IP | RAB3A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT621667 | UBE4B | ubiquitination factor E4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT639906 | SRGAP2 | SLIT-ROBO Rho GTPase activating protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651436 | XRCC5 | X-ray repair cross complementing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683853 | ZNF208 | zinc finger protein 208 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684841 | TPGS2 | tubulin polyglutamylase complex subunit 2 | ![]() |
![]() |
2 | 5 | ||||||
MIRT689347 | ZNF83 | zinc finger protein 83 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692492 | SPIN4 | spindlin family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695711 | OLA1 | Obg like ATPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698219 | TMEM248 | transmembrane protein 248 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711560 | FAM20B | FAM20B, glycosaminoglycan xylosylkinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT712867 | TMEM67 | transmembrane protein 67 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722956 | TSPAN1 | tetraspanin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723622 | SOBP | sine oculis binding protein homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT724176 | ABCF2 | ATP binding cassette subfamily F member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT755363 | LMBR1 | limb development membrane protein 1 | 3 | 1 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|