pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1246 |
Genomic Coordinates | chr2: 176600980 - 176601052 |
Synonyms | MIRN1246, hsa-mir-1246, MIR1246 |
Description | Homo sapiens miR-1246 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1246 | |||||||||
Sequence | 11| AAUGGAUUUUUGGAGCAGG |29 | |||||||||
Evidence | Experimental | |||||||||
Experiments | Illumina | |||||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | USP48 | ||||||||||||||||||||
Synonyms | RAP1GA1, USP31 | ||||||||||||||||||||
Description | ubiquitin specific peptidase 48 | ||||||||||||||||||||
Transcript | NM_032236 | ||||||||||||||||||||
Other Transcripts | NM_001032730 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on USP48 | |||||||||||||||||||||
3'UTR of USP48 (miRNA target sites are highlighted) |
>USP48|NM_032236|3'UTR 1 TCTTTGAATACTTGCTGACTGCTAAGAAATGACCAGAGGGGAAGAGGAGTTTGACATGTTAGGGCATTAAAGCAAAGGTG 81 GATTTAAGAATTAAACCATTACATGCCCCTTCCAAAAGGCAGAAATCCATTCAAACGTGACTGTCCCAAATGCCTTATGT 161 CAAATAAAGCAGATTGCACTGATGGACATCAGACTTGAAGGAAATGTTTCCAATTTTATATTTAAGGGGGGTGGTGGGTG 241 GGAGGGGGCAAGTAAAGACGGAACAAGTTTAGTAGCAGTAATAGTAAATCATGTTTACATATGAGATTTATAGTCGTGGG 321 AGGGGAATAAAGTTCTGTTATATTTCCTTGCTCGAGTTTCATACCAGATGCGTTGGTCCATAAAGGATTGTATCAAGTAG 401 ATGGGACAACATTCTGCTCTGAACGAAAAGTAATTTTAGAGACATAACCTGCTTACCAATGCCTGTCTTTGATTCATATT 481 CTACTTTCAATAAAGCATGAAAGTGAAGAACTTGTCCTAAGTGTGGAAAAGTGTCTTCAGATTTAGACTCTTCTCCATGT 561 CAGCTGCAGCGCCACCCGCCTTACACCTGCCCGGCCGTCTGTCTCTTGGTATTGGGTAAAGGAGGGGGCACCTGCATGTC 641 TCCTGCAATGAGCAAGGAATTATGTCTCATGTTTTGACTTCAGAGGCTTTTTGCTTTGGTGCATTTCAGAAAGGATGGAG 721 AACATTTATTATGTGTGAAAGCATCCTCTTCCGGTTTTGCTGTTATTCAAAAGTGGGAAATGTACCTGGCACGTTTGAAA 801 ATAAAAAATCTGACTACCTATCAGAAGAGTAAATCAGAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 84196.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM4903825 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / PID14_NS |
Location of target site | NM_032236 | 3UTR | ACAUGCCCCUUCCAAAAGGCAGAAAUCCAUUCAAAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161237 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714642 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000219689.7 | 3UTR | AAAAUCCAUUACACAGUCACUUUACG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000219689.7 | 3UTR | AAAAUCCAUUACACAGUCACUUUACG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
52 hsa-miR-1246 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT053774 | DYRK1A | dual specificity tyrosine phosphorylation regulated kinase 1A | 4 | 1 | ||||||||
MIRT196431 | TAOK1 | TAO kinase 1 | 2 | 6 | ||||||||
MIRT444394 | ZNF480 | zinc finger protein 480 | 2 | 2 | ||||||||
MIRT447596 | MSH3 | mutS homolog 3 | 2 | 2 | ||||||||
MIRT454049 | TMBIM4 | transmembrane BAX inhibitor motif containing 4 | 2 | 2 | ||||||||
MIRT458257 | ZNF85 | zinc finger protein 85 | 2 | 2 | ||||||||
MIRT461493 | KIAA1009 | centrosomal protein 162 | 1 | 1 | ||||||||
MIRT474057 | LMNB2 | lamin B2 | 2 | 2 | ||||||||
MIRT479231 | CKS2 | CDC28 protein kinase regulatory subunit 2 | 2 | 6 | ||||||||
MIRT485663 | CHD7 | chromodomain helicase DNA binding protein 7 | 2 | 2 | ||||||||
MIRT485735 | CALM2 | calmodulin 2 | 2 | 2 | ||||||||
MIRT498809 | SRRT | serrate, RNA effector molecule | 2 | 8 | ||||||||
MIRT501190 | SKIL | SKI like proto-oncogene | 2 | 2 | ||||||||
MIRT502619 | DGS2 | DiGeorge syndrome/velocardiofacial syndrome complex 2 | 2 | 6 | ||||||||
MIRT502665 | CTC1 | CST telomere replication complex component 1 | 2 | 13 | ||||||||
MIRT512313 | ADCY9 | adenylate cyclase 9 | 2 | 6 | ||||||||
MIRT513756 | PIM1 | Pim-1 proto-oncogene, serine/threonine kinase | 2 | 2 | ||||||||
MIRT514651 | CRADD | CASP2 and RIPK1 domain containing adaptor with death domain | 2 | 2 | ||||||||
MIRT514865 | SHOX2 | short stature homeobox 2 | 2 | 2 | ||||||||
MIRT527109 | ARHGAP15 | Rho GTPase activating protein 15 | 2 | 2 | ||||||||
MIRT527145 | GPATCH11 | G-patch domain containing 11 | 2 | 2 | ||||||||
MIRT528507 | HTR7 | 5-hydroxytryptamine receptor 7 | 2 | 4 | ||||||||
MIRT532109 | RRP8 | ribosomal RNA processing 8 | 2 | 2 | ||||||||
MIRT534601 | RORA | RAR related orphan receptor A | 2 | 2 | ||||||||
MIRT538906 | BRI3BP | BRI3 binding protein | 2 | 4 | ||||||||
MIRT544541 | GDE1 | glycerophosphodiester phosphodiesterase 1 | 2 | 2 | ||||||||
MIRT547430 | MED4 | mediator complex subunit 4 | 2 | 2 | ||||||||
MIRT553029 | USP48 | ubiquitin specific peptidase 48 | 2 | 2 | ||||||||
MIRT555136 | PTPRD | protein tyrosine phosphatase, receptor type D | 2 | 2 | ||||||||
MIRT562091 | KIAA0895 | KIAA0895 | 2 | 2 | ||||||||
MIRT562584 | CBX3 | chromobox 3 | 2 | 4 | ||||||||
MIRT563747 | ZNF763 | zinc finger protein 763 | 2 | 2 | ||||||||
MIRT573310 | AKR7A2 | aldo-keto reductase family 7 member A2 | 2 | 2 | ||||||||
MIRT687232 | PLAGL2 | PLAG1 like zinc finger 2 | 2 | 2 | ||||||||
MIRT704465 | CREBRF | CREB3 regulatory factor | 2 | 2 | ||||||||
MIRT718817 | PYGO1 | pygopus family PHD finger 1 | 2 | 2 | ||||||||
MIRT731194 | NFIB | nuclear factor I B | 2 | 1 | ||||||||
MIRT732503 | SPRED2 | sprouty related EVH1 domain containing 2 | 3 | 0 | ||||||||
MIRT733489 | MIF | macrophage migration inhibitory factor | 2 | 0 | ||||||||
MIRT734071 | SRSF1 | serine and arginine rich splicing factor 1 | 2 | 0 | ||||||||
MIRT734733 | AR | androgen receptor | 3 | 0 | ||||||||
MIRT734755 | GLS2 | glutaminase 2 | 2 | 0 | ||||||||
MIRT735248 | CFTR | cystic fibrosis transmembrane conductance regulator | 8 | 1 | ||||||||
MIRT736017 | ELAVL1 | ELAV like RNA binding protein 1 | 2 | 0 | ||||||||
MIRT736329 | DNAH3 | dynein axonemal heavy chain 3 | 2 | 0 | ||||||||
MIRT737381 | CCNG2 | cyclin G2 | 2 | 0 | ||||||||
MIRT755524 | FOXA2 | forkhead box A2 | 3 | 1 | ||||||||
MIRT755713 | DIXDC1 | DIX domain containing 1 | 2 | 1 | ||||||||
MIRT755714 | WNT9A | Wnt family member 9A | 2 | 1 | ||||||||
MIRT755715 | RAC2 | Rac family small GTPase 2 | 2 | 1 | ||||||||
MIRT755716 | FRAT2 | FRAT2, WNT signaling pathway regulator | 2 | 1 | ||||||||
MIRT756132 | ACE2 | angiotensin I converting enzyme 2 | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|