pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4491 |
Genomic Coordinates | chr11: 111347757 - 111347824 |
Description | Homo sapiens miR-4491 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4491 | ||||||||||||||||||||||||
Sequence | 46| AAUGUGGACUGGUGUGACCAAA |67 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TRPC3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | SCA41, TRP3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | transient receptor potential cation channel subfamily C member 3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_001130698 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_003305 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on TRPC3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of TRPC3 (miRNA target sites are highlighted) |
>TRPC3|NM_001130698|3'UTR 1 TGCAGCAACCTGGATTTGGCTTTGACTATAGCACAAATGTGGGCAATAATATTTCTAAGTATGAAATACTTGAAAAACTA 81 TGATGTAAATTTTTAGTATTAACTACCTTTATCATGTGAACCTTTAAAAGTTAGCTCTTAATGGTTTTATTGTTTTATCA 161 CATGAAAATGCATTTTATTTGTCTGCTTTGACATTACAGTGGCATACCATTGTGTTGAAAAGCCCAATATTACTATATTA 241 TTGAAACTTTTATTCATTTTAGAGTAAACTCCACATCTTTGCACTACCTGTTTGCCTCCAAGAGACTATCAGTTCCTTGG 321 GGACAGGGACCATGTCTTATTCATCTTTGTGTCTCCAGCATCTAGTACAGTGCCTGGTATATAGTAGGTGCTCAATAAAT 401 GTTGAAACCAACTGAACTGCCAACAAAATAAAAATAAAAAGTCTTCACTATGTAGCATACCTTCCCTTGTCCAAGTTCTG 481 AAGAGGTTTTTTTTTTTTTTTTTTAATAGAAACTGAAGACATTTTACAACCAGCTATGACTTGGTAAGACATTCTTAGAA 561 TTTTAGGTGTCACTGATAATCCTAGAACCACTGAGCCCCAAGTGAAGAATTTAACAACAAAATGGGTTAATGAAAAATAT 641 AATTACATTGTATATTTAAGTTTCATAGAATTATTTAAAACAACACATTAAAGATTTTTCTAAAATAT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 7222.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000264811.5 | 3UTR | UAAACUCCACAUCUUUGCACUACCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000264811.5 | 3UTR | UAAACUCCACAUCUUUGCACUACCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
67 hsa-miR-4491 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT056779 | ARID5B | AT-rich interaction domain 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT061577 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT063828 | SRP9 | signal recognition particle 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT102306 | DNAJB9 | DnaJ heat shock protein family (Hsp40) member B9 | ![]() |
![]() |
2 | 10 | ||||||
MIRT186634 | COX20 | COX20, cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 8 | ||||||
MIRT191243 | STYX | serine/threonine/tyrosine interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT195908 | SRSF11 | serine and arginine rich splicing factor 11 | ![]() |
![]() |
2 | 4 | ||||||
MIRT240343 | UBXN2B | UBX domain protein 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT271178 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT286219 | TMEM97 | transmembrane protein 97 | ![]() |
![]() |
2 | 4 | ||||||
MIRT314182 | OCLN | occludin | ![]() |
![]() |
2 | 4 | ||||||
MIRT323938 | AKAP2 | A-kinase anchoring protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT323940 | PALM2-AKAP2 | PALM2-AKAP2 readthrough | ![]() |
![]() |
2 | 4 | ||||||
MIRT340113 | TXLNA | taxilin alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT450333 | LRWD1 | leucine rich repeats and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451283 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451879 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT453577 | CRCP | CGRP receptor component | ![]() |
![]() |
2 | 2 | ||||||
MIRT454366 | ASAH2 | N-acylsphingosine amidohydrolase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454797 | STOML3 | stomatin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459801 | POTED | POTE ankyrin domain family member D | ![]() |
![]() |
2 | 10 | ||||||
MIRT460911 | POLQ | DNA polymerase theta | ![]() |
![]() |
2 | 2 | ||||||
MIRT468082 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT470281 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471876 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476147 | GPR137C | G protein-coupled receptor 137C | ![]() |
![]() |
2 | 8 | ||||||
MIRT478056 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | ![]() |
![]() |
2 | 10 | ||||||
MIRT501054 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT501732 | OVOL1 | ovo like transcriptional repressor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT502214 | HSPB8 | heat shock protein family B (small) member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505243 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505957 | RAN | RAN, member RAS oncogene family | ![]() |
![]() |
2 | 6 | ||||||
MIRT507996 | BCL2L13 | BCL2 like 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510433 | ZNF207 | zinc finger protein 207 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510827 | SBNO1 | strawberry notch homolog 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT511493 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512129 | CREBL2 | cAMP responsive element binding protein like 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT514512 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516482 | RAB32 | RAB32, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT519514 | RBM22 | RNA binding motif protein 22 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523367 | GTF2A1 | general transcription factor IIA subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524217 | DDI2 | DNA damage inducible 1 homolog 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT524649 | C4orf32 | family with sequence similarity 241 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT528297 | ZNF76 | zinc finger protein 76 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528577 | ITGB3BP | integrin subunit beta 3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT530458 | SULT1B1 | sulfotransferase family 1B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535774 | MYCN | MYCN proto-oncogene, bHLH transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT544239 | CCBL2 | kynurenine aminotransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546733 | RNF217 | ring finger protein 217 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550360 | INCENP | inner centromere protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT553343 | TRPC3 | transient receptor potential cation channel subfamily C member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT556629 | LAPTM4A | lysosomal protein transmembrane 4 alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT558006 | FAM122B | family with sequence similarity 122B | ![]() |
![]() |
2 | 2 | ||||||
MIRT558994 | CA8 | carbonic anhydrase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560418 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565717 | SESN3 | sestrin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566271 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568161 | CCDC6 | coiled-coil domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569753 | C2orf71 | chromosome 2 open reading frame 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573959 | FIGNL1 | fidgetin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574530 | PEG10 | paternally expressed 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609453 | CCDC149 | coiled-coil domain containing 149 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614047 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628418 | ATMIN | ATM interactor | ![]() |
![]() |
2 | 2 | ||||||
MIRT689556 | XPO6 | exportin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725598 | CDH7 | cadherin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT735561 | TRIM7 | tripartite motif containing 7 | ![]() |
![]() |
![]() |
3 | 0 |