>TARBP2|NM_004178|3'UTR
   1 AGCCCCAGCTGGACTCATGGATGTGCACCCTTTGCTCCCTGCTCTTTCTGCCTCTGGGCTCATGTATCTGCGCAGCTCTG
  81 GTACCCTCTGTGGGTGCCATCTCTACCTCTGACACAGACTGCCTGCCTTGAAGCTGAGAAGGCACAGGGCAAGGAGCCAA
 161 GGACCACAGAGCCTCAGCCAGCCCAGGATCCGTCCTCATTTTATTGGTGATGATGAATGGGAATGAAATCAGGGGGCTGT
 241 CTACTAGAGCCTGGAATAAATATGCTGCTTTGTGGATTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 321 AAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agCUGACGGUGAGAAUGAUCu 5' |:|||:| |||||| Target 5' ggGGCTGTC-----TACTAGa 3'	233 - 248	125.00	-14.60
2	miRNA 3' agCU-GAC-GGUG-AGAAUGAUCu 5' || | | || | |:|||:|:| Target 5' agGATCCGTCCTCATTTTATTGGt 3'	185 - 208	119.00	-8.70
3	miRNA 3' agCUG-ACGGUGAGAAUGAucu 5' ||: ||| | :||:|| Target 5' tgGATGTGCACCCTTTGCTccc 3'	18 - 39	99.00	-7.32

Mutant ID	Mutant Position	Mutant Source
COSN31554832	3	COSMIC
COSN30473334	6	COSMIC
COSN28876142	22	COSMIC
COSN30177846	24	COSMIC
COSN30524696	39	COSMIC
COSN30506357	40	COSMIC
COSN31540315	98	COSMIC
COSN30187955	110	COSMIC
COSN28812429	209	COSMIC
COSN31483849	242	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs568796843	2	dbSNP
rs767686359	6	dbSNP
rs750204119	7	dbSNP
rs1303409598	9	dbSNP
rs1380699334	11	dbSNP
rs1423088988	13	dbSNP
rs539489466	18	dbSNP
rs766053638	19	dbSNP
rs753874744	21	dbSNP
rs754908800	22	dbSNP
rs1247635221	23	dbSNP
rs750331078	24	dbSNP
rs764848884	26	dbSNP
rs376072604	27	dbSNP
rs752218932	29	dbSNP
rs758146970	31	dbSNP
rs1482312106	32	dbSNP
rs1462439135	34	dbSNP
rs201937693	35	dbSNP
rs758150043	37	dbSNP
rs371130451	38	dbSNP
rs1168828171	39	dbSNP
rs756569872	40	dbSNP
rs1409223430	41	dbSNP
rs1015897163	43	dbSNP
rs766141270	43	dbSNP
rs375653873	45	dbSNP
rs990519804	52	dbSNP
rs1364100736	56	dbSNP
rs1241444633	58	dbSNP
rs2531	59	dbSNP
rs540730822	64	dbSNP
rs1294930306	65	dbSNP
rs1433367946	67	dbSNP
rs895247433	72	dbSNP
rs865946250	73	dbSNP
rs1466021617	77	dbSNP
rs1022441650	81	dbSNP
rs1170635842	85	dbSNP
rs1450151580	86	dbSNP
rs1474369753	90	dbSNP
rs555550158	91	dbSNP
rs1186834640	101	dbSNP
rs1418677935	102	dbSNP
rs978399323	105	dbSNP
rs1425362598	107	dbSNP
rs1463064142	115	dbSNP
rs1256531694	116	dbSNP
rs923782799	125	dbSNP
rs1276688115	127	dbSNP
rs1345079403	128	dbSNP
rs1019620844	130	dbSNP
rs1340771541	133	dbSNP
rs574204578	135	dbSNP
rs935211665	137	dbSNP
rs1340677655	138	dbSNP
rs780176078	142	dbSNP
rs1395803381	147	dbSNP
rs1377704001	148	dbSNP
rs1310325074	155	dbSNP
rs1430487808	157	dbSNP
rs1291021604	164	dbSNP
rs544802344	180	dbSNP
rs1459687847	184	dbSNP
rs138108626	192	dbSNP
rs117830235	193	dbSNP
rs545668585	198	dbSNP
rs947379214	200	dbSNP
rs1253906725	208	dbSNP
rs143775286	211	dbSNP
rs1182731496	218	dbSNP
rs1248924891	231	dbSNP
rs1293515177	231	dbSNP
rs1336398738	232	dbSNP
rs1356691149	232	dbSNP
rs185547953	239	dbSNP
rs1039469222	244	dbSNP
rs546700312	247	dbSNP
rs907745713	250	dbSNP
rs1320216475	264	dbSNP
rs73313239	268	dbSNP
rs1410921775	274	dbSNP
rs1045529392	275	dbSNP
rs907133067	277	dbSNP
rs1306305760	280	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.