pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-605 |
Genomic Coordinates | chr10: 51299573 - 51299655 |
Synonyms | MIRN605, hsa-mir-605, MIR605 |
Description | Homo sapiens miR-605 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-605-3p | ||||||||||||||||||||||||||||
Sequence | 51| AGAAGGCACUAUGAGAUUUAGA |72 | ||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SMARCE1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | BAF57, CSS5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_003079 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on SMARCE1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of SMARCE1 (miRNA target sites are highlighted) |
>SMARCE1|NM_003079|3'UTR 1 GTGTTGCCTTGTTTTGTGTGTTCTAAATACTTTTTTTAATGAAAAAATGTTTTTTGGTTTTAATGGTGTTACGTGGTTTG 81 TGTATTAATTTTTTTTCTTGTCCATATCACACCACCAAAGGCTTTTGGACCATTTAGCATCATGAGCCTAATGGCTCAGT 161 CAGTCACCTTTCTTAAGTGTTGTGAAGATGGCTCTTTTCTTTGGATCTTGTTTCTAGCCCTCAACTGCTGAAAGCCTCAG 241 AATTTAGATTAATTGAGAAAACACCCACCTCTTTTAGAGAATTATCCTTTGATGCTGCAGAATCTACTCTTACAATGCCT 321 TCCTACAGCTCACTGGGGTGCTTACCAAAGCCATAGCTTTAAACCTTCCCAGTCCCCATCAGTAGCTTCCTGAAAGTCTC 401 CTCTCTTGTTTACTTCTGCAAAGGGTAGCTTCTTAAAAACGTGATCATGTATGAGTATGTATTTGTTCACTTACCCTTTT 481 TTACTTTTAATCAATGTCAGATACCAAGAGTTGTGTTAAGCTGAGTGTAGTGTGTAACTAACTACACTTGGATCTTACTG 561 ATCCAGAAATAGTCCCCATAGTTAGAGTAGTTACTTATGAAGTGGTTATTAAAGTGAACACAGCACATATACATTATCTA 641 TACTGCTTTTTGTTATGATTAATACTGGGTATGTTCTGGTAAATCCATCCTTATTGTATAGAAAAAAAATTACTTTTTTA 721 CCAGGTTTTCCAAAGACAGAATAGATCACAAAGCTCAAGGAATTTAATATTCTTGTAATGGACTAGATAATTCAAACTGA 801 TTAGCCCATTCCAGAAGAAAAACAGCTGGGAATTAAGTTAATCCACTTGAAATTGTTTTACAATAATCAGAACATCCAAA 881 CCTCAAGGCTCAGGATCCCATAGACCAGAGCCCACCTTTTTGATAAACTTAGTAAAGTCTTGGAGACTAGAAGCAAGATA 961 GTTTGTGACACATAAGCTTCCCAAAAACTAGAATAGATTTTTACTGAATAGTGGTATATCTGATGGTATATGTTTCTTAA 1041 AGGTCCAAATGTAATAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 6605.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000377808.4 | 3UTR | UAGAGAAUUAUCCUUUGAUGCUGCAGAAUCUACUCUUACAAUGCCUUCCUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
100 hsa-miR-605-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT061339 | WEE1 | WEE1 G2 checkpoint kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT061584 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT076140 | WDR81 | WD repeat domain 81 | ![]() |
![]() |
2 | 2 | ||||||
MIRT079361 | CCDC137 | coiled-coil domain containing 137 | ![]() |
![]() |
2 | 2 | ||||||
MIRT079547 | VAMP3 | vesicle associated membrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT096242 | CANX | calnexin | ![]() |
![]() |
2 | 2 | ||||||
MIRT243877 | G3BP1 | G3BP stress granule assembly factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT249186 | AKIRIN1 | akirin 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT273604 | SP1 | Sp1 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT316766 | FOXC1 | forkhead box C1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT322410 | PPP2R2A | protein phosphatase 2 regulatory subunit Balpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT370117 | TRIB3 | tribbles pseudokinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT392725 | UBN2 | ubinuclein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT406910 | PTBP1 | polypyrimidine tract binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT407440 | CTDSP1 | CTD small phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441887 | RD3 | retinal degeneration 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT444979 | C15orf52 | chromosome 15 open reading frame 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445241 | FOXD4 | forkhead box D4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445500 | FOXD4L5 | forkhead box D4 like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445503 | FOXD4L4 | forkhead box D4 like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447025 | FOXD4L1 | forkhead box D4 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447743 | TMCC3 | transmembrane and coiled-coil domain family 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448761 | HDX | highly divergent homeobox | ![]() |
![]() |
2 | 2 | ||||||
MIRT450003 | HAX1 | HCLS1 associated protein X-1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452830 | FAM131B | family with sequence similarity 131 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452872 | LAX1 | lymphocyte transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453506 | ARRB1 | arrestin beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454169 | HIST1H2BK | histone cluster 1 H2B family member k | ![]() |
![]() |
2 | 2 | ||||||
MIRT458742 | CES2 | carboxylesterase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459166 | HSPA6 | heat shock protein family A (Hsp70) member 6 | ![]() |
![]() |
2 | 21 | ||||||
MIRT460246 | IL17RB | interleukin 17 receptor B | ![]() |
![]() |
2 | 4 | ||||||
MIRT460514 | SDE2 | SDE2 telomere maintenance homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT460698 | RNF157 | ring finger protein 157 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461481 | METTL1 | methyltransferase like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462617 | C20orf27 | chromosome 20 open reading frame 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT463233 | ZNF131 | zinc finger protein 131 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465699 | TNPO2 | transportin 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT466304 | TIMM22 | translocase of inner mitochondrial membrane 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468957 | RPS14 | ribosomal protein S14 | ![]() |
![]() |
2 | 6 | ||||||
MIRT469571 | RARA | retinoic acid receptor alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT469685 | RAB5B | RAB5B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT470800 | PMP22 | peripheral myelin protein 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471649 | PANK2 | pantothenate kinase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT471722 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472281 | NFIB | nuclear factor I B | ![]() |
![]() |
2 | 4 | ||||||
MIRT473680 | MAPKBP1 | mitogen-activated protein kinase binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475859 | H6PD | hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT477326 | EPHA2 | EPH receptor A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477831 | DYRK3 | dual specificity tyrosine phosphorylation regulated kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478572 | CTNND1 | catenin delta 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT479634 | CD81 | CD81 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT481950 | ANKRD11 | ankyrin repeat domain 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483696 | ZNF74 | zinc finger protein 74 | ![]() |
![]() |
2 | 6 | ||||||
MIRT488798 | MALT1 | MALT1 paracaspase | ![]() |
![]() |
2 | 2 | ||||||
MIRT489066 | STARD3 | StAR related lipid transfer domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492533 | PSMD11 | proteasome 26S subunit, non-ATPase 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492857 | NRARP | NOTCH regulated ankyrin repeat protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT496793 | BTRC | beta-transducin repeat containing E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT500122 | ZNF106 | zinc finger protein 106 | ![]() |
![]() |
2 | 4 | ||||||
MIRT505359 | TMEM167A | transmembrane protein 167A | ![]() |
![]() |
2 | 2 | ||||||
MIRT506786 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510692 | SRM | spermidine synthase | ![]() |
![]() |
2 | 6 | ||||||
MIRT515841 | CEP104 | centrosomal protein 104 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516448 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT528855 | PKP1 | plakophilin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533848 | TET3 | tet methylcytosine dioxygenase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539025 | ATXN7L1 | ataxin 7 like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542872 | NR6A1 | nuclear receptor subfamily 6 group A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546543 | SATB2 | SATB homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554114 | SMARCE1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560569 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560796 | EPM2AIP1 | EPM2A interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562836 | GCFC2 | GC-rich sequence DNA-binding factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563109 | IFRD2 | interferon related developmental regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564177 | MRPL49 | mitochondrial ribosomal protein L49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564283 | ASB1 | ankyrin repeat and SOCS box containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564350 | USP22 | ubiquitin specific peptidase 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565279 | TNFRSF21 | TNF receptor superfamily member 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565338 | TMEM104 | transmembrane protein 104 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565905 | SCAMP2 | secretory carrier membrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567108 | ITGB1 | integrin subunit beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567601 | FANCF | Fanconi anemia complementation group F | ![]() |
![]() |
2 | 2 | ||||||
MIRT567779 | DGAT2 | diacylglycerol O-acyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568075 | CENPQ | centromere protein Q | ![]() |
![]() |
2 | 2 | ||||||
MIRT624304 | COL12A1 | collagen type XII alpha 1 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT644395 | CDKL1 | cyclin dependent kinase like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661547 | ZNF674 | zinc finger protein 674 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670949 | IRAK3 | interleukin 1 receptor associated kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672951 | AKAP5 | A-kinase anchoring protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697426 | ZFP36 | ZFP36 ring finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT700793 | PIAS2 | protein inhibitor of activated STAT 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702657 | ITGA3 | integrin subunit alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708945 | FZR1 | fizzy and cell division cycle 20 related 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713657 | PLCE1 | phospholipase C epsilon 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719239 | CYSLTR2 | cysteinyl leukotriene receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719951 | BLOC1S6 | biogenesis of lysosomal organelles complex 1 subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722048 | HLA-E | major histocompatibility complex, class I, E | ![]() |
![]() |
2 | 2 | ||||||
MIRT722201 | URM1 | ubiquitin related modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724790 | C1D | C1D nuclear receptor corepressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT734347 | CYP2B6 | cytochrome P450 family 2 subfamily B member 6 | ![]() |
![]() |
![]() |
3 | 0 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|