miRTarBase - #MIRT555058


—
pre-miRNA Information
pre-miRNA hsa-mir-4690   
Genomic Coordinates chr11: 65636310 - 65636369
Description Homo sapiens miR-4690 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4690-5p
Sequence 1| GAGCAGGCGAGGCUGGGCUGAA |22
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM5426974 4 COSMIC
COSM7294383 4 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs762767645 3 dbSNP
rs1158020577 4 dbSNP
rs1031810148 7 dbSNP
rs763979181 8 dbSNP
rs751083148 11 dbSNP
rs1338601494 12 dbSNP
rs1403894228 14 dbSNP
rs541332946 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PYURF
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 100996939.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aagucgggucggagCGGACGAg 5'
                        ||||||| 
Target 5' ------cuuuuacaGCCUGCUc 3'
 		1 - 16
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000273968.4 | 3UTR | cuuuuacagccugcucuugccuauuaccauaccag
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
42 hsa-miR-4690-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT071223 FCF1 FCF1, rRNA-processing protein 2 2
MIRT082025 COX6B1 cytochrome c oxidase subunit 6B1 2 4
MIRT144286 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT202048 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT213227 REST RE1 silencing transcription factor 2 6
MIRT445866 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 2 2
MIRT455955 CYP4A22 cytochrome P450 family 4 subfamily A member 22 2 2
MIRT459110 CYP4A11 cytochrome P450 family 4 subfamily A member 11 2 2
MIRT460327 SH3RF1 SH3 domain containing ring finger 1 2 2
MIRT461645 ZSWIM4 zinc finger SWIM-type containing 4 2 2
MIRT463497 ZC3H10 zinc finger CCCH-type containing 10 2 2
MIRT464900 UBALD1 UBA like domain containing 1 2 2
MIRT472262 NFIC nuclear factor I C 2 2
MIRT478028 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT483753 ALDH9A1 aldehyde dehydrogenase 9 family member A1 2 2
MIRT485186 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 4
MIRT486550 DCTN4 dynactin subunit 4 2 2
MIRT495087 IGSF3 immunoglobulin superfamily member 3 2 2
MIRT495141 ZNRF1 zinc and ring finger 1 2 2
MIRT501269 NHS NHS actin remodeling regulator 2 4
MIRT503264 KIF18B kinesin family member 18B 2 2
MIRT507165 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT512519 BTBD19 BTB domain containing 19 2 2
MIRT528862 PKP1 plakophilin 1 2 2
MIRT546526 SERTAD3 SERTA domain containing 3 2 2
MIRT555058 PYURF PIGY upstream reading frame 2 2
MIRT574028 RIMBP3C RIMS binding protein 3C 2 2
MIRT574106 VASN vasorin 2 2
MIRT630923 UNC93A unc-93 homolog A 2 2
MIRT640178 AGO1 argonaute 1, RISC catalytic component 2 2
MIRT655959 NDST1 N-deacetylase and N-sulfotransferase 1 2 2
MIRT659747 CCDC30 coiled-coil domain containing 30 2 2
MIRT666062 STK40 serine/threonine kinase 40 2 2
MIRT670696 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 4
MIRT674196 GJD3 gap junction protein delta 3 2 2
MIRT686948 SFT2D3 SFT2 domain containing 3 2 2
MIRT697466 ZC3H4 zinc finger CCCH-type containing 4 2 2
MIRT698221 TMEM248 transmembrane protein 248 2 2
MIRT699448 SLC1A5 solute carrier family 1 member 5 2 2
MIRT718999 UTP15 UTP15, small subunit processome component 2 2
MIRT720024 TFAP2C transcription factor AP-2 gamma 2 2
MIRT721530 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4690 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-miR-4690-5p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4690-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4690-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4690-5p Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4690-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4690-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-4690-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-4690-5p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4690-5p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-4690-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-4690-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4690-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4690-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4690-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4690-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission