miRTarBase - #MIRT557208


—
pre-miRNA Information
pre-miRNA hsa-mir-516b-1   
Genomic Coordinates chr19: 53736845 - 53736934
Synonyms MIRN516-4, MIRN516B-1, MIRN516B1, MIR516B1
Description Homo sapiens miR-516b-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-516b-2   
Genomic Coordinates chr19: 53725442 - 53725526
Synonyms MIRN516-3, MIRN516B-2, MIRN516B2, MIR516B2
Description Homo sapiens miR-516b-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-516b-3p
Sequence 56| UGCUUCCUUUCAGAGGGU |73
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1413434631 1 dbSNP
rs746170707 2 dbSNP
rs1312744198 2 dbSNP
rs752101959 3 dbSNP
rs770077784 4 dbSNP
rs1193425541 6 dbSNP
rs953142850 7 dbSNP
rs1020245150 7 dbSNP
rs775845942 11 dbSNP
rs1402471980 11 dbSNP
rs760158839 15 dbSNP
rs78861479 16 dbSNP
rs765933705 16 dbSNP
Putative Targets

Gene Information
Gene Symbol HNRNPF   
Synonyms HNRPF, OK/SW-cl.23, mcs94-1
Description heterogeneous nuclear ribonucleoprotein F
Transcript NM_001098204   
Other Transcripts NM_001098205 , NM_001098206 , NM_001098207 , NM_001098208 , NM_004966   
Expression
Putative miRNA Targets on HNRNPF
3'UTR of HNRNPF
(miRNA target sites are highlighted)		 
>HNRNPF|NM_001098204|3'UTR
   1 TTTTGTTAGGAACATTTGAGTTACTTCAATCATTTTCACAGGCAGCCAACAAGCAATTAAGAGCAGTTATAATAGAGGAA
  81 GCTGGGGGACCCATTTTGCACCATGAGTTTGTGAAAAATCTGGATTAAAAAATTACCTCTTCAGTGTTTTCTCATGCAAA
 161 ATTTTCTTCTAGCATGTGATAATGAGTAAACTAAAACTATTTTCAGCTTTTCTCAATTAACATTTTGGTAGTATACTTCA
 241 GAGTGATGTTATCTAAGTTTAAGTAGTTTAAGTATGTTAAATGTGGATCTTTTACACCACATCACAGTGAACACACTGGG
 321 GAGACGTGCTTTTTTGGAAAACTCAAAGGTGCTAGCTCCCTGATTCAAAGAAATATTTCTCATGTTTGTTCATTCTAGTT
 401 TATATTTTCATTTAAAATCCTTTAGGTTAAGTTTAAGCTTTTTAAAAGTTAGTTTTGAGAATTGAGACACAATACTAATA
 481 CTGTAGGAATTGGTGAGGCCTTGACTTAAAACTTTCTTTGTACTGTGATTTCCTTTTGGGTGTATTTTGCTAAGTGAAAC
 561 TTGTTAAATTTTTTGTTAACTAAATTTTTTTCTTAAAATAAAGACTTTTTCACAATGACTGGCACAGATTACTCAGCAAA
 641 AGATAGCAAAACGGGTGGTTGAAGATAATTCATTTTAATCGTAATGTATTTTAGTGTGAATTTAAAAATTTCATACATCA
 721 AATCTATGATCTCCCTTATATTCTTATGATGAGGCTAAATAAAAGTCTAATAAAAATGTTAAATATGTGAATGGTGGAAA
 801 TGGTGACTAGCAGCACACATTCTGGGAAGCATCAAATAGACACACGGCCCCAGCCACCTGCAACTTATGTGCACTGTTGT
 881 AAACCATTCAGAATTTTCCTGCTAGGCCCTTGATGCTGGAGTCACATCTGTTGATAGCTGGAGAACTTTAGTTTCAAGTA
 961 CTACATTGTGAAAGCAATTATTTTGTTTCTAGTTTTTATAAAATGCTGATTTAAACTTTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugggagacUUUCCUUCGu 5'
                  |:||||||| 
Target 5' gttataatAGAGGAAGCt 3'
 66 - 83 146.00 -10.70
2 
miRNA  3' uggGAGACUUUCCUUCGu 5'
             :|||   :|||||| 
Target 5' acaTTCT---GGGAAGCa 3'
 817 - 831 128.00 -14.20
3 
miRNA  3' uggGAGACUUUCCUUCGu 5'
             :|:| | ||| ||| 
Target 5' tcaTTTTCACAGGCAGCc 3'
 30 - 47 119.00 -5.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30104195 23 COSMIC
COSN30170288 28 COSMIC
COSN1119064 29 COSMIC
COSN31601473 51 COSMIC
COSN30505416 53 COSMIC
COSN30493007 71 COSMIC
COSN30156489 75 COSMIC
COSN30502598 106 COSMIC
COSN31486379 115 COSMIC
COSN30501466 145 COSMIC
COSN26559180 172 COSMIC
COSN8640081 184 COSMIC
COSN31488328 204 COSMIC
COSN6970810 511 COSMIC
COSN30174358 556 COSMIC
COSN31568290 567 COSMIC
COSN23299632 594 COSMIC
COSN15328482 714 COSMIC
COSN28665661 730 COSMIC
COSN10067896 1008 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs752284116 1 dbSNP
rs374231673 4 dbSNP
rs1367721885 8 dbSNP
rs201748393 14 dbSNP
rs1425251705 16 dbSNP
rs1269297363 19 dbSNP
rs1336862203 20 dbSNP
rs1247978662 22 dbSNP
rs745877705 24 dbSNP
rs1274731018 28 dbSNP
rs199696858 29 dbSNP
rs768045050 33 dbSNP
rs1313644598 37 dbSNP
rs576923654 39 dbSNP
rs765070824 42 dbSNP
rs1192731505 45 dbSNP
rs1356219950 46 dbSNP
rs754143332 48 dbSNP
rs1404031335 49 dbSNP
rs1247422649 50 dbSNP
rs763769612 51 dbSNP
rs1030764966 54 dbSNP
rs1206422821 56 dbSNP
rs1365059240 57 dbSNP
rs371934952 61 dbSNP
rs1423901796 63 dbSNP
rs997579712 65 dbSNP
rs1387190362 70 dbSNP
rs965184555 77 dbSNP
rs1317388781 78 dbSNP
rs1803714 84 dbSNP
rs1265484215 86 dbSNP
rs540504138 89 dbSNP
rs1229189239 94 dbSNP
rs1319813835 99 dbSNP
rs1358160495 103 dbSNP
rs1294663737 105 dbSNP
rs1297466237 114 dbSNP
rs1435473931 118 dbSNP
rs1364181674 120 dbSNP
rs1348193170 124 dbSNP
rs1448907620 136 dbSNP
rs572777763 137 dbSNP
rs1384652830 139 dbSNP
rs1433135732 143 dbSNP
rs1161579794 150 dbSNP
rs759332250 153 dbSNP
rs10409 164 dbSNP
rs1458348125 165 dbSNP
rs1457866355 166 dbSNP
rs1042251940 169 dbSNP
rs1436794815 174 dbSNP
rs1320894897 184 dbSNP
rs1381390051 186 dbSNP
rs1367161876 194 dbSNP
rs1316541208 202 dbSNP
rs1170890391 204 dbSNP
rs535809284 211 dbSNP
rs896130823 212 dbSNP
rs1056547680 214 dbSNP
rs1209590899 221 dbSNP
rs1242822440 222 dbSNP
rs368475745 223 dbSNP
rs1460160333 228 dbSNP
rs770594533 228 dbSNP
rs937764609 234 dbSNP
rs369913142 252 dbSNP
rs1158351347 254 dbSNP
rs1361848301 255 dbSNP
rs144005766 260 dbSNP
rs372890561 265 dbSNP
rs1404818801 266 dbSNP
rs1467936172 268 dbSNP
rs1304031186 274 dbSNP
rs1033078304 275 dbSNP
rs909381087 275 dbSNP
rs1305575784 278 dbSNP
rs1337888317 283 dbSNP
rs1452925441 287 dbSNP
rs1229328831 289 dbSNP
rs1262910274 292 dbSNP
rs983677919 293 dbSNP
rs1267480586 298 dbSNP
rs548983313 301 dbSNP
rs1208660020 306 dbSNP
rs1256637292 308 dbSNP
rs1480389381 311 dbSNP
rs1487473495 317 dbSNP
rs781200413 318 dbSNP
rs766385838 319 dbSNP
rs11548186 325 dbSNP
rs187150871 326 dbSNP
rs923282518 344 dbSNP
rs1428365230 348 dbSNP
rs1229051224 358 dbSNP
rs1479239867 363 dbSNP
rs1341251028 366 dbSNP
rs976512779 376 dbSNP
rs1226486689 381 dbSNP
rs374306171 382 dbSNP
rs551223636 391 dbSNP
rs1411002446 395 dbSNP
rs1282981833 396 dbSNP
rs1386222834 397 dbSNP
rs1344071078 398 dbSNP
rs1388649689 399 dbSNP
rs1302316848 401 dbSNP
rs1307152402 404 dbSNP
rs1202447161 408 dbSNP
rs1253180964 417 dbSNP
rs1483967150 430 dbSNP
rs1017677510 438 dbSNP
rs1267879662 454 dbSNP
rs1310458526 455 dbSNP
rs1430918645 456 dbSNP
rs774638734 462 dbSNP
rs768843772 468 dbSNP
rs979494546 471 dbSNP
rs376095980 472 dbSNP
rs1167650775 475 dbSNP
rs1391500961 478 dbSNP
rs1167057534 479 dbSNP
rs1478809202 482 dbSNP
rs1430925351 483 dbSNP
rs967817362 487 dbSNP
rs771641140 489 dbSNP
rs1438985283 490 dbSNP
rs552631203 492 dbSNP
rs139521821 494 dbSNP
rs1431021734 509 dbSNP
rs1253311069 513 dbSNP
rs1205848913 516 dbSNP
rs1343015583 520 dbSNP
rs529013340 520 dbSNP
rs1009459732 523 dbSNP
rs567144282 533 dbSNP
rs1291018391 545 dbSNP
rs1449804990 572 dbSNP
rs1482662608 575 dbSNP
rs1272242230 578 dbSNP
rs763282242 580 dbSNP
rs1247096575 585 dbSNP
rs775789809 590 dbSNP
rs1184453784 592 dbSNP
rs143891929 592 dbSNP
rs764202527 603 dbSNP
rs1162395015 605 dbSNP
rs117712109 606 dbSNP
rs1165870402 607 dbSNP
rs34445024 611 dbSNP
rs752976985 611 dbSNP
rs147376570 621 dbSNP
rs1322881901 628 dbSNP
rs1366004036 644 dbSNP
rs1451929182 646 dbSNP
rs941105096 649 dbSNP
rs1290266552 652 dbSNP
rs562975768 653 dbSNP
rs551052502 654 dbSNP
rs1316159860 655 dbSNP
rs1206426968 657 dbSNP
rs1411006477 662 dbSNP
rs747600964 667 dbSNP
rs887914279 677 dbSNP
rs1048388721 678 dbSNP
rs1182404440 680 dbSNP
rs929555544 683 dbSNP
rs1474047135 689 dbSNP
rs1370415361 694 dbSNP
rs1306579229 704 dbSNP
rs1407711455 712 dbSNP
rs34807604 712 dbSNP
rs539723067 716 dbSNP
rs532238802 718 dbSNP
rs923557315 722 dbSNP
rs976101434 723 dbSNP
rs181502268 726 dbSNP
rs540022753 729 dbSNP
rs13376803 730 dbSNP
rs1342390471 731 dbSNP
rs1284771687 743 dbSNP
rs1372545996 744 dbSNP
rs1226279675 746 dbSNP
rs142778208 747 dbSNP
rs988404993 753 dbSNP
rs542218456 754 dbSNP
rs1211422949 765 dbSNP
rs1443711198 765 dbSNP
rs1413565248 777 dbSNP
rs190233547 777 dbSNP
rs1232749999 783 dbSNP
rs949052219 790 dbSNP
rs771511594 791 dbSNP
rs747470016 793 dbSNP
rs138369783 794 dbSNP
rs925456870 796 dbSNP
rs749691400 803 dbSNP
rs1189520986 808 dbSNP
rs1353819425 810 dbSNP
rs578192347 811 dbSNP
rs1289959943 822 dbSNP
rs777327422 828 dbSNP
rs867467821 835 dbSNP
rs780230873 836 dbSNP
rs185372679 837 dbSNP
rs1346698987 839 dbSNP
rs976132693 842 dbSNP
rs1016621272 843 dbSNP
rs1271717354 845 dbSNP
rs1270096926 846 dbSNP
rs878862746 859 dbSNP
rs1482330235 860 dbSNP
rs1207976785 863 dbSNP
rs966427836 865 dbSNP
rs1229018499 867 dbSNP
rs114311147 868 dbSNP
rs1287076481 869 dbSNP
rs1478499842 870 dbSNP
rs1450773222 880 dbSNP
rs1417521130 882 dbSNP
rs1427709512 884 dbSNP
rs986234959 885 dbSNP
rs765583727 891 dbSNP
rs1404043990 893 dbSNP
rs80027918 902 dbSNP
rs1026828959 905 dbSNP
rs1233548045 908 dbSNP
rs902017556 909 dbSNP
rs995743104 916 dbSNP
rs1231247938 919 dbSNP
rs752374095 923 dbSNP
rs1015910722 925 dbSNP
rs750602030 926 dbSNP
rs767847250 927 dbSNP
rs1456306287 928 dbSNP
rs1269946933 929 dbSNP
rs1013472603 931 dbSNP
rs1192799330 949 dbSNP
rs1246260614 955 dbSNP
rs1164974316 957 dbSNP
rs1451473042 961 dbSNP
rs528215857 970 dbSNP
rs1390639672 975 dbSNP
rs1457372349 975 dbSNP
rs1161191791 977 dbSNP
rs1392679467 981 dbSNP
rs1398335399 985 dbSNP
rs896174142 989 dbSNP
rs1126709 991 dbSNP
rs1436566276 992 dbSNP
rs548856161 1000 dbSNP
rs1359292629 1001 dbSNP
rs369573297 1006 dbSNP
rs7905676 1010 dbSNP
rs1460161558 1011 dbSNP
rs903604440 1013 dbSNP
rs1189250978 1015 dbSNP
rs1242634050 1016 dbSNP
rs180922191 1020 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugggaGACUUUCCUUCGu 5'
               |||  :||:| | 
Target 5' --aagCUG--GGGGACCc 3'
 		1 - 14
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3185.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugggagacuuUCCUUCGu 5'
                    ||||||| 
Target 5' ----------AGGAAGCu 3'
 		1 - 8
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000357065.4 | 3UTR | AAGCUGGGGGACCCAUUUUGCACCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000357065.4 | 3UTR | AGGAAGCUGGGGGACCCAUUUUGCACCAUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE17306 Multiple myeloma -0.198 8.6e-2 0.210 7.4e-2 49 Click to see details
GSE27834 Pluripotent stem cells 0.324 1.1e-1 0.276 1.5e-1 16 Click to see details
GSE32688 Pancreatic cancer -0.07 3.5e-1 -0.092 3.1e-1 32 Click to see details
GSE21849 B cell lymphoma -0.041 4.2e-1 0.105 2.9e-1 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.028 4.5e-1 -0.096 3.2e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
85 hsa-miR-516b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT077049 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT155261 IFNAR2 interferon alpha and beta receptor subunit 2 2 4
MIRT446119 ASTN1 astrotactin 1 2 2
MIRT447355 STOM stomatin 2 2
MIRT469329 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT470201 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT475944 GXYLT1 glucoside xylosyltransferase 1 2 4
MIRT498268 KIAA1644 KIAA1644 2 2
MIRT501725 OVOL1 ovo like transcriptional repressor 1 2 2
MIRT522860 KIAA1551 KIAA1551 2 2
MIRT527900 B3GALT5 beta-1,3-galactosyltransferase 5 2 4
MIRT528557 DNAAF3 dynein axonemal assembly factor 3 2 2
MIRT531250 PDF peptide deformylase, mitochondrial 2 2
MIRT534410 SENP1 SUMO1/sentrin specific peptidase 1 2 2
MIRT544656 MED19 mediator complex subunit 19 2 2
MIRT550681 YARS tyrosyl-tRNA synthetase 2 2
MIRT557208 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 4
MIRT611532 DDB1 damage specific DNA binding protein 1 2 2
MIRT612087 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT616535 PARD6B par-6 family cell polarity regulator beta 2 4
MIRT616738 DCTN5 dynactin subunit 5 2 2
MIRT616754 SVOP SV2 related protein 2 4
MIRT617380 FAM227A family with sequence similarity 227 member A 2 2
MIRT617624 RAB3IP RAB3A interacting protein 2 2
MIRT620778 MT1A metallothionein 1A 2 2
MIRT623172 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT626034 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT627376 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT630533 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT631686 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 2 2
MIRT633896 FGF10 fibroblast growth factor 10 2 2
MIRT635933 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT636275 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 2 2
MIRT636285 RAD51L3-RFFL RAD51L3-RFFL readthrough 2 2
MIRT636502 GDAP1L1 ganglioside induced differentiation associated protein 1 like 1 2 2
MIRT638037 SHPK sedoheptulokinase 2 2
MIRT639162 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT639571 GORASP1 golgi reassembly stacking protein 1 2 2
MIRT641248 CENPN centromere protein N 2 2
MIRT643650 MYOCD myocardin 2 2
MIRT645490 TRIM63 tripartite motif containing 63 2 2
MIRT648016 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT648102 LRRFIP1 LRR binding FLII interacting protein 1 2 2
MIRT648729 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT650177 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT652787 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT653248 SORD sorbitol dehydrogenase 2 2
MIRT654859 PPM1F protein phosphatase, Mg2+/Mn2+ dependent 1F 2 2
MIRT655533 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT656390 MCU mitochondrial calcium uniporter 2 2
MIRT656881 KIF1C kinesin family member 1C 2 2
MIRT657083 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT657629 GPX8 glutathione peroxidase 8 (putative) 2 2
MIRT658295 FAM83F family with sequence similarity 83 member F 2 2
MIRT659432 COL1A1 collagen type I alpha 1 chain 2 2
MIRT659791 CBLB Cbl proto-oncogene B 2 2
MIRT660153 BRCC3 BRCA1/BRCA2-containing complex subunit 3 2 2
MIRT660490 ARRDC3 arrestin domain containing 3 2 2
MIRT660503 ARPC2 actin related protein 2/3 complex subunit 2 2 2
MIRT666356 SIKE1 suppressor of IKBKE 1 2 2
MIRT677774 FKTN fukutin 2 2
MIRT688556 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT697415 ZFP91 ZFP91 zinc finger protein 2 2
MIRT709468 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT711154 WDR82P1 WD repeat domain 82 pseudogene 1 2 2
MIRT711467 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT712515 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT712661 PCTP phosphatidylcholine transfer protein 2 2
MIRT713304 TYRP1 tyrosinase related protein 1 2 2
MIRT714597 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT716603 MPPED1 metallophosphoesterase domain containing 1 2 2
MIRT717537 PYGO2 pygopus family PHD finger 2 2 2
MIRT718058 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT718539 PIGQ phosphatidylinositol glycan anchor biosynthesis class Q 2 2
MIRT719768 ZNF236 zinc finger protein 236 2 2
MIRT720162 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT720360 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT721182 HOPX HOP homeobox 2 2
MIRT721278 RAD54L2 RAD54 like 2 2 2
MIRT721357 ENTHD1 ENTH domain containing 1 2 2
MIRT721504 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT721918 LINGO2 leucine rich repeat and Ig domain containing 2 2 2
MIRT722278 LURAP1 leucine rich adaptor protein 1 2 2
MIRT722789 FUT4 fucosyltransferase 4 2 2
MIRT724390 ABAT 4-aminobutyrate aminotransferase 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-516b Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-516b Bromocriptine approved 31101 Microarray Prolactinoma 22366961 2012 up-regulated
miR-516b Bromocriptine approved 31101 Quantitative real-time PCR Prolactinoma 22366961 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-516b-3p Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-516b-3p Ribavirin+Pegylated IFNa-2b sensitive tissue (chronic hepatitis C)
hsa-miR-516b-3p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-516b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-516b-3p Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)

Error report submission