pre-miRNA Information
pre-miRNA hsa-mir-103b-1   
Genomic Coordinates chr5: 168560904 - 168560965
Description Homo sapiens miR-103b-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-103b-2   
Genomic Coordinates chr20: 3917502 - 3917563
Description Homo sapiens miR-103b-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-103b
Sequence 1| UCAUAGCCCUGUACAAUGCUGCU |23
Evidence Experimental
Experiments ChIP-seq
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN28198041 16 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369221403 4 dbSNP
rs1283132774 7 dbSNP
rs1222085747 10 dbSNP
rs572980521 14 dbSNP
rs748411363 15 dbSNP
rs769854452 23 dbSNP
Putative Targets

Gene Information
Gene Symbol DMTF1   
Synonyms DMP1, DMTF, MRUL, hDMP1
Description cyclin D binding myb like transcription factor 1
Transcript NM_021145   
Other Transcripts NM_001142327 , NM_001142326   
Expression
Putative miRNA Targets on DMTF1
3'UTR of DMTF1
(miRNA target sites are highlighted)
>DMTF1|NM_021145|3'UTR
   1 AATAATTCTTAGAAATAGGCAGTTCAAGCAAAGAAGGCACACTGTTAATTACAACCTCTTCAAAGAAATAGGAGCAACCC
  81 CCAAGAGGCTTAATTTACCAATTTAAATAGCCACAGTCCTTAAGCCACACACATTGTTGCTGCTATGACTTTTTACCTCC
 161 TTTAAACACATCATCTGAGGTTGAGTTTTATGACAGTATGTAGTTGAGTGGAGGCTGGGAGTTTTAAGCATAAATCCCTG
 241 TTTAGTGTTACATGGGAATAAGGAATTTCATTCACTTCAGCCACTAAGAAAAGTTTAGAATCACGAAAGCTTAACTGCTG
 321 TGGTTTAAAGTACAGTTTCTCTAAAGATCAGACATGGCACTGTCTCCTCTCAAGCCTGGTTGTAGTTCAGATGAGTCTTT
 401 TCAACATGGTCTTCAACATGGTCTAGAGCTTACCAGTGATCTTCTGATCTTCAAGAAGACTAAGTTTGAGACTTGACCAG
 481 CATACAAGTATAGAGACCTAGGAGGTGGTCTTGTGGTGGTACATTTGGTTAACCCATTGCTGGCAGTGGGAGCTGATTTA
 561 GGCAGGGTAAACAGGAAAGCATTAAAAGTTAAAATTCACTACAGGTTTTTTGTTACTTTTAAAGGGAATATGGATAAGCA
 641 TAGTAACAAAACCCACCAGAATCTAAGCAGTTTTCACCCCCTCAGAAACCACTGTCATTAGTTTACAAAGTTAGCACTTT
 721 GAAGTAAAACTAAATGAGGAAGGAAGTAATGTTACCTATCCTTGATACCATGACCATTTATTAGATGTTTTGCTATATAA
 801 ATTACCGAGAGAATAGTTTGTCATCCACTTAGTGTGTTAGCTGGTGGGGTACAATATAACCTCTCATCTCAGGCTATTTT
 881 AAAAAAACAATATTTGCTTCTATAACAAAAGGAAACAAATCTAAGAATCATTCCTGTACTACAGAAGGGTTAAGGCAAAG
 961 GTAGCCTTTTGGGCTTTTTAATGAATATGACCCCTATAGAAAAGTCAAGAAAAAAAAACCCTTGTATAAATTATTTTATT
1041 TATTATTGTAATTAGATCTTCACAAAGTTGTCTTTTCACTGTGTTTTGTCAACGTGAAATTAAATTGTAGTTATAAGCAA
1121 AAGTTGGTTGCCTAGGGAACAATTGTATATTCAGTTTAACAGAAATAAAAGAATATTTGTCTTAAGATGCAAAAAAAAAA
1201 AAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucGUCGUAACAUGUCCCGAUACu 5'
            || |||||| ::  |||||| 
Target 5' caCA-CATTGT-TGCTGCTATGa 3'
128 - 148 131.00 -14.60
2
miRNA  3' ucgucGUAACAUGUCCCGAUAcu 5'
               || | | || ||||||  
Target 5' cctctCA-TCT-CA-GGCTATtt 3'
860 - 879 123.00 -6.90
3
miRNA  3' ucgUCGUA---ACAUG------UCCCGAUACu 5'
             | |||   |||||      ||||:|| | 
Target 5' agaATCATTCCTGTACTACAGAAGGGTTAAGg 3'
924 - 955 114.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN5104701 8 COSMIC
COSN30489049 13 COSMIC
COSN30491038 18 COSMIC
COSN30140855 19 COSMIC
COSN30102191 34 COSMIC
COSN19749852 53 COSMIC
COSN31605434 66 COSMIC
COSN21655800 121 COSMIC
COSN31608035 141 COSMIC
COSN30138250 161 COSMIC
COSN30543993 349 COSMIC
COSN30175148 375 COSMIC
COSN31571672 384 COSMIC
COSN20104409 414 COSMIC
COSN8517781 418 COSMIC
COSN25117153 427 COSMIC
COSN30176795 511 COSMIC
COSN24302191 555 COSMIC
COSN16795541 681 COSMIC
COSN31491237 722 COSMIC
COSN31535849 743 COSMIC
COSN22052732 785 COSMIC
COSN21984946 871 COSMIC
COSN30176297 984 COSMIC
COSN29736466 1019 COSMIC
COSN6896892 1021 COSMIC
COSN31585671 1132 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1252036360 1 dbSNP
rs748064387 3 dbSNP
rs367850382 6 dbSNP
rs375445374 7 dbSNP
rs1375365140 8 dbSNP
rs1465123167 9 dbSNP
rs1424187676 14 dbSNP
rs772842492 17 dbSNP
rs370181911 19 dbSNP
rs1377380535 23 dbSNP
rs1408040308 32 dbSNP
rs755052290 33 dbSNP
rs1351281426 35 dbSNP
rs1208689628 42 dbSNP
rs1012729858 45 dbSNP
rs778486847 45 dbSNP
rs1273512035 48 dbSNP
rs11541453 53 dbSNP
rs145434463 54 dbSNP
rs772391012 59 dbSNP
rs1304877906 64 dbSNP
rs906919455 70 dbSNP
rs998096555 71 dbSNP
rs998526858 78 dbSNP
rs1323006383 88 dbSNP
rs1029441664 102 dbSNP
rs889643065 125 dbSNP
rs147200363 126 dbSNP
rs1275199358 133 dbSNP
rs1389295301 134 dbSNP
rs555702904 134 dbSNP
rs1174232662 135 dbSNP
rs764359109 138 dbSNP
rs1243996885 139 dbSNP
rs969092355 149 dbSNP
rs1461569105 150 dbSNP
rs964867212 150 dbSNP
rs1185164816 155 dbSNP
rs1202567656 164 dbSNP
rs976194160 164 dbSNP
rs1281453517 166 dbSNP
rs530419785 166 dbSNP
rs1202503061 168 dbSNP
rs1343517587 169 dbSNP
rs1274714029 172 dbSNP
rs1030374877 174 dbSNP
rs1337599838 175 dbSNP
rs1475038457 190 dbSNP
rs1168496797 195 dbSNP
rs1313289690 197 dbSNP
rs1415904223 198 dbSNP
rs1399984037 199 dbSNP
rs1420947942 200 dbSNP
rs1032131400 205 dbSNP
rs868024991 207 dbSNP
rs1413498961 209 dbSNP
rs1175206195 213 dbSNP
rs747488345 214 dbSNP
rs1257717828 222 dbSNP
rs1212697428 225 dbSNP
rs1441047569 234 dbSNP
rs1278610610 238 dbSNP
rs757634454 241 dbSNP
rs1406403176 244 dbSNP
rs1331364377 246 dbSNP
rs1266354863 262 dbSNP
rs983491678 273 dbSNP
rs1454285083 274 dbSNP
rs1286109484 276 dbSNP
rs1450033423 287 dbSNP
rs36101169 289 dbSNP
rs909243106 305 dbSNP
rs769143602 306 dbSNP
rs942005260 312 dbSNP
rs1390693934 314 dbSNP
rs140503843 315 dbSNP
rs1456193698 319 dbSNP
rs970232448 327 dbSNP
rs915783990 328 dbSNP
rs948542032 334 dbSNP
rs561631484 335 dbSNP
rs1237231868 337 dbSNP
rs1194302350 342 dbSNP
rs1466659159 342 dbSNP
rs907034166 344 dbSNP
rs1208194100 349 dbSNP
rs909641002 361 dbSNP
rs1226796270 363 dbSNP
rs1292357189 363 dbSNP
rs1354038788 365 dbSNP
rs528743484 368 dbSNP
rs547191265 369 dbSNP
rs1011636488 386 dbSNP
rs1318379529 389 dbSNP
rs918284991 392 dbSNP
rs1349936304 398 dbSNP
rs1461864496 400 dbSNP
rs148183534 400 dbSNP
rs933895785 405 dbSNP
rs112653404 417 dbSNP
rs1168871526 419 dbSNP
rs1451651656 423 dbSNP
rs1246799713 430 dbSNP
rs1188468819 433 dbSNP
rs947202989 434 dbSNP
rs1248493336 437 dbSNP
rs1446222621 440 dbSNP
rs1193742795 453 dbSNP
rs889590607 458 dbSNP
rs532684946 459 dbSNP
rs1228870769 460 dbSNP
rs1479148650 460 dbSNP
rs1344024936 462 dbSNP
rs1039492592 473 dbSNP
rs1295382536 478 dbSNP
rs1198031347 479 dbSNP
rs1227535474 483 dbSNP
rs1368166587 491 dbSNP
rs1294800165 496 dbSNP
rs904605787 502 dbSNP
rs1429439920 503 dbSNP
rs983576310 506 dbSNP
rs1016735984 513 dbSNP
rs1000723940 528 dbSNP
rs1168551497 539 dbSNP
rs1455107171 541 dbSNP
rs1031664692 549 dbSNP
rs551084896 555 dbSNP
rs1189560378 558 dbSNP
rs1156450046 565 dbSNP
rs1477700264 570 dbSNP
rs956049742 573 dbSNP
rs963421300 574 dbSNP
rs1014491433 579 dbSNP
rs1384626402 580 dbSNP
rs991192814 582 dbSNP
rs915835172 583 dbSNP
rs767238031 586 dbSNP
rs1401671491 587 dbSNP
rs1303238347 590 dbSNP
rs1320802299 592 dbSNP
rs1344135042 595 dbSNP
rs1404929174 598 dbSNP
rs1283983402 602 dbSNP
rs1411238432 604 dbSNP
rs1347542565 605 dbSNP
rs1237074899 617 dbSNP
rs1368270817 621 dbSNP
rs569321220 626 dbSNP
rs1307829305 639 dbSNP
rs970179833 642 dbSNP
rs1361409323 648 dbSNP
rs980297111 654 dbSNP
rs184558044 679 dbSNP
rs758907038 682 dbSNP
rs149756367 683 dbSNP
rs766163646 684 dbSNP
rs928484308 686 dbSNP
rs1184387870 697 dbSNP
rs1471746876 709 dbSNP
rs1205536606 718 dbSNP
rs534588010 724 dbSNP
rs1483453714 726 dbSNP
rs531554684 731 dbSNP
rs918232532 736 dbSNP
rs1207905575 743 dbSNP
rs1471593376 756 dbSNP
rs1268243386 758 dbSNP
rs1229644181 762 dbSNP
rs1348256052 771 dbSNP
rs1287247948 773 dbSNP
rs1221733132 778 dbSNP
rs188921888 781 dbSNP
rs914279270 787 dbSNP
rs1389956600 788 dbSNP
rs867804282 791 dbSNP
rs1179163013 807 dbSNP
rs1165737195 809 dbSNP
rs1039148067 814 dbSNP
rs1424233082 814 dbSNP
rs1179859300 815 dbSNP
rs1482896338 820 dbSNP
rs1050938937 824 dbSNP
rs1210061040 825 dbSNP
rs145596626 826 dbSNP
rs1267164643 830 dbSNP
rs911142444 835 dbSNP
rs1245037839 839 dbSNP
rs1323107644 841 dbSNP
rs1311057758 845 dbSNP
rs1395750599 846 dbSNP
rs1366568418 847 dbSNP
rs1323138277 859 dbSNP
rs773537224 861 dbSNP
rs997751550 877 dbSNP
rs1387973548 881 dbSNP
rs942653837 882 dbSNP
rs1459666967 883 dbSNP
rs1051946471 885 dbSNP
rs1162443522 885 dbSNP
rs780893464 886 dbSNP
rs747952358 889 dbSNP
rs879457326 889 dbSNP
rs1005430147 891 dbSNP
rs1041661530 896 dbSNP
rs1389772329 903 dbSNP
rs1263247525 907 dbSNP
rs903715390 912 dbSNP
rs1244609235 922 dbSNP
rs772926895 924 dbSNP
rs1343308970 934 dbSNP
rs759470840 937 dbSNP
rs1000267727 948 dbSNP
rs1012331606 954 dbSNP
rs1023677860 957 dbSNP
rs1365048476 957 dbSNP
rs538389935 962 dbSNP
rs556637468 965 dbSNP
rs1053213761 966 dbSNP
rs1241509571 970 dbSNP
rs15386 975 dbSNP
rs1388849756 980 dbSNP
rs73208512 987 dbSNP
rs1423834795 990 dbSNP
rs758507049 992 dbSNP
rs1014272322 994 dbSNP
rs1447608793 995 dbSNP
rs1198960159 998 dbSNP
rs981382547 998 dbSNP
rs1292436474 999 dbSNP
rs1434396317 1002 dbSNP
rs1489151172 1005 dbSNP
rs1193536689 1006 dbSNP
rs1249263031 1007 dbSNP
rs1483611597 1009 dbSNP
rs879624680 1010 dbSNP
rs928513748 1010 dbSNP
rs989017448 1010 dbSNP
rs73208513 1011 dbSNP
rs1235596448 1012 dbSNP
rs1300907353 1014 dbSNP
rs947158390 1020 dbSNP
rs906111499 1021 dbSNP
rs1427510919 1022 dbSNP
rs1180192707 1023 dbSNP
rs1173080205 1028 dbSNP
rs1002226972 1030 dbSNP
rs1038745889 1031 dbSNP
rs921626101 1034 dbSNP
rs762912347 1035 dbSNP
rs1051977960 1043 dbSNP
rs886656457 1046 dbSNP
rs541771490 1054 dbSNP
rs1017088258 1061 dbSNP
rs963226476 1065 dbSNP
rs1387671553 1067 dbSNP
rs1437603471 1068 dbSNP
rs1460955163 1073 dbSNP
rs756007843 1073 dbSNP
rs1202678231 1076 dbSNP
rs1038315794 1082 dbSNP
rs1459533672 1093 dbSNP
rs972431219 1094 dbSNP
rs560691243 1095 dbSNP
rs1334983905 1097 dbSNP
rs1407832436 1100 dbSNP
rs573507412 1135 dbSNP
rs986429829 1144 dbSNP
rs1384964397 1145 dbSNP
rs910923231 1160 dbSNP
rs1315517951 1163 dbSNP
rs9684 1167 dbSNP
rs1323406001 1170 dbSNP
rs540551717 1172 dbSNP
rs1225224356 1174 dbSNP
rs1457245811 1177 dbSNP
rs1413802148 1179 dbSNP
rs76828576 1182 dbSNP
rs532749998 1183 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 9988.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucGUCGUAACAUGUCCCGAUACu 5'
            || |||||| ::  |||||| 
Target 5' caCA-CAUUGU-UGCUGCUAUG- 3'
4 - 23
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001142327 | 3UTR | AAAGAAAUAGGAGCAACCCCCAAGAGGCUUAAUUUACCAAUUUAAAUAGCCACAGUCCUUAAGCCACACACAUUGUUGCUGCUAUGACUUUUUACCUCCUUUAAACACAUCAUCUGAGGUUGAGUUUUAUGACAGUAUGUAGUUGAGUGGAGGCUGGGAGUUUUAAGCAUAAAUCCCUGUUUAGUGUUACAUGGGAAUAAGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001142327 | 3UTR | UAGGAGCAACCCCCAAGAGGCUUAAUUUACCAAUUUAAAUAGCCACAGUCCUUAAGCCACACACAUUGUUGCUGCUAUGACUUUUUACCUCCUUUAAACACAUCAUCUGAGGUUGAGUUUUAUGACAGUAUGUAGUUGAGUGGAGGCUGGGAGUUUUAAGCAUAAAUCCCUGUUUAGUGUUACAUGGGAAUAAGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001142327 | 3UTR | UUCAAAGAAAUAGGAGCAACCCCCAAGAGGCUUAAUUUACCAAUUUAAAUAGCCACAGUCCUUAAGCCACACACAUUGUUGCUGCUAUGACUUUUUACCUCCUUUAAACACAUCAUCUGAGGUUGAGUUUUAUGACAGUAUGUAGUUGAGUGGAGGCUGGGAGUUUUAAGCAUAAAUCCCUGUUUAGUGUUACAUGGGAAUAAGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001142327 | 3UTR | GAGCAACCCCCAAGAGGCUUAAUUUACCAAUUUAAAUAGCCACAGUCCUUAAGCCACACACAUUGUUGCUGCUAUGACUUUUUACCUCCUUUAAACACAUCAUCUGAGGUUGAGUUUUAUGACAGUAUGUAGUUGAGUGGAGGCUGGGAGUUUUAAGCAUAAAUCCCUGUUUAGUGUUACAUGGGAAUAAGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001142327 | 3UTR | CCAAGAGGCUUAAUUUACCAAUUUAAAUAGCCACAGUCCUUAAGCCACACACAUUGUUGCUGCUAUGACUUUUUACCUCCUUUAAACACAUCAUCUGAGGUUGAGUUUUAUGACAGUAUGUAGUUGAGUGGAGGCUGGGAGUUUUAAGCAUAAAUCCCUGUUUAGUGUUACAUGGGAAUAAGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001142327 | 3UTR | AACCCCCAAGAGGCUUAAUUUACCAAUUUAAAUAGCCACAGUCCUUAAGCCACACACAUUGUUGCUGCUAUGACUUUUUACCUCCUUUAAACACAUCAUCUGAGGUUGAGUUUUAUGACAGUAUGUAGUUGAGUGGAGGCUGGGAGUUUUAAGCAUAAAUCCCUGUUUAGUGUUACAUGGGAAUAAGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000413276.2 | 3UTR | CCACACACAUUGUUGCUGCUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.788 6.9e-4 0.786 7.2e-4 13 Click to see details
GSE28544 Breast cancer -0.252 1.2e-1 -0.121 2.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
53 hsa-miR-103b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT218386 E2F3 E2F transcription factor 3 2 2
MIRT404221 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT441502 SPG20 spartin 2 6
MIRT444124 ZNRF3 zinc and ring finger 3 2 2
MIRT454236 OSBPL10 oxysterol binding protein like 10 2 4
MIRT457919 ZNF212 zinc finger protein 212 2 2
MIRT462254 LAMA4 laminin subunit alpha 4 2 2
MIRT463176 ZNF281 zinc finger protein 281 2 2
MIRT472355 TSPAN1 tetraspanin 1 2 2
MIRT474133 LIN54 lin-54 DREAM MuvB core complex component 2 4
MIRT494946 IFFO2 intermediate filament family orphan 2 2 2
MIRT497403 NPY4R neuropeptide Y receptor Y4 2 2
MIRT497641 GLDN gliomedin 2 2
MIRT505340 TMEM245 transmembrane protein 245 2 6
MIRT505680 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT510706 SREK1IP1 SREK1 interacting protein 1 2 6
MIRT512198 C1orf43 chromosome 1 open reading frame 43 2 2
MIRT522089 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT525074 FRK fyn related Src family tyrosine kinase 2 2
MIRT531276 PPIL3 peptidylprolyl isomerase like 3 2 2
MIRT535119 PLXNA2 plexin A2 2 2
MIRT540836 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541018 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT545752 CA12 carbonic anhydrase 12 2 4
MIRT546404 SRP9 signal recognition particle 9 2 2
MIRT547991 HCFC2 host cell factor C2 2 4
MIRT554502 SAE1 SUMO1 activating enzyme subunit 1 2 2
MIRT558360 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT558863 CD2AP CD2 associated protein 2 2
MIRT559939 ZNF567 zinc finger protein 567 2 2
MIRT566300 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT567490 FOXK1 forkhead box K1 2 2
MIRT617139 ZNF556 zinc finger protein 556 2 2
MIRT625400 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT626491 CEP89 centrosomal protein 89 2 2
MIRT629487 GSN gelsolin 2 4
MIRT638456 PLXDC2 plexin domain containing 2 2 2
MIRT648498 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT654845 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT664587 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT664977 TDRD1 tudor domain containing 1 2 2
MIRT665028 ELK1 ELK1, ETS transcription factor 2 2
MIRT666043 STON2 stonin 2 2 2
MIRT668863 CRY2 cryptochrome circadian clock 2 2 2
MIRT669297 C17orf85 nuclear cap binding subunit 3 2 2
MIRT680975 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682267 RS1 retinoschisin 1 2 2
MIRT685283 KIAA1143 KIAA1143 2 2
MIRT693375 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT701785 MSL1 male specific lethal 1 homolog 2 2
MIRT709373 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT715154 IL12B interleukin 12B 2 2
MIRT734499 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-103b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-103b Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)

Error report submission