miRTarBase - #MIRT558540


—
pre-miRNA Information
pre-miRNA hsa-mir-6501   
Genomic Coordinates chr21: 33550662 - 33550728
Description Homo sapiens miR-6501 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6501-5p
Sequence 3| AGUUGCCAGGGCUGCCUUUGGU |24
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
1055619 20 ClinVar
COSM5974214 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs756127353 5 dbSNP
rs764400023 6 dbSNP
rs753967693 8 dbSNP
rs1283296362 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CSNK1G3   
Synonyms CKI-gamma 3, CSNK1G3L
Description casein kinase 1 gamma 3
Transcript NM_001031812   
Other Transcripts NM_001044723 , NM_004384   
Expression
Putative miRNA Targets on CSNK1G3
3'UTR of CSNK1G3
(miRNA target sites are highlighted)		 
>CSNK1G3|NM_001031812|3'UTR
   1 CTCTGGACACAGACAGATCCTGGGGAGTTACTTACATGTTCATCTGCTGTCTTGTGATTAAAATCATCTCTGTAGTGACC
  81 ACGTATATTTTCAAGGACTCACTCTTAGAAACAAAAATGTCATACTTTCATACTTCATTTTGTGGTTGTCTTACATTCTT
 161 TTTCTTTTTTTTTTTTTCTCTAATTTAACCTTTATGGAAGCTTTAAAGTTTTGTCAAAACATGAGTGCTTTGCCCATCAG
 241 TGAATGGAATGGACCAATGAGGTGGTATCAATGAATATAGTTCCATAGAACATTTTCCAGAAGTTCTTCTGTTGTAGAAA
 321 GCAGTACAGTATCTTAAGTGTCAACCAGTTATATACCTAATCTGGTTTTTTATAACTTCTGTAAGAGCATAATCAAACAG
 401 GAATTTTCTTTTCTCAGTGGATAATACAACAGAGAAAACAGAGTTGCCCAAATATTTAAAAGAAGTTATTCCTTGAGAAG
 481 TTCATATTTTGTGACATCTGCATTGATTTCAGTATTACTGATGGTACTGTTATTCATAAGTCATATTAACATTCTCTCCG
 561 TGAAATCATGGTACAGTCACTGCCCAGAGGTACTGAGGAAAAAGCAATATGGGTTCGGCAGATGGTGGTGGTAAAATGAA
 641 TCTTAAGGAGTGTGGTAAATATGTGCTCCGCTTTTGTTGCATCACTATGTGAAGTACTGTGTTGCAGAAGTGGCAAAAGC
 721 GCTTATTTTTAAAAATGCAAAATATTTGTACAATGTAACTTTATGCTTCCAAATAATAATGTATGTTAGACAGCAAGAAA
 801 TGAATACTTTAAAAAGTGATGTATGTTGGAGTTATAAAGAAATACACTAAGGAGAGGTAGTAAATGTGAACCTTGTTGCA
 881 GTGTATAAGGTGGAAGCCTAAAGAAATCTCACCGAAACTTACTGCTGAATGATTACATTCTCCCTTAAGCAGAAAACTTT
 961 GGATGTGCCATGCAATGGTGTCTGTGTAATTATTTTGCTCTTTGATTAAAAAAAAGACCCCCAGCAATAAAAAGTGGGTC
1041 ACTCTATGCCCTCTGTGCACATTAGTCTCTTGTATTCAACTTTGCTGATTCTCTGGAATTTTCCTACTCTTTAGCATAAT
1121 TTTGATGATTGAAAAATATTTTGGAAAGGATGGGTCAGGTGCTTTGCCTCCATAGTCTTTTGAAGTGCCTGCATATGAAC
1201 AACAACAACAACAACAAAAAATTCTGTAAAAAAGGAAGCCCATTCCACTTTTCAAGTATGCTTTGTTTTAAGCCATAAAG
1281 ACACACATGTAGTTTTGTCACATTCTACTAGCCAAAATTTTCAAGAAGGGTTAAAACAAAGACTGGCTAGAAAGATAATT
1361 ATTTTGAATAAATCTCATATTCATCTTTCATTTATATAATTGTTACTTATTCCTCCCATGCAGTCTCTTCGTTGTCTTTA
1441 AGTGTGTGCCTCCAGGCATGCTTATTTATTTTTATTGTCTCAAGGTAACATTTAAGATGTATATTAAAGTAAAGCTACAT
1521 TTTTTTACTTCATTATTGCATTTACAGGGATTTAATTGTACTTTGTAATTTATTTTTCTTATTAGCCAAAAGTTTAATGC
1601 ATTTTTTTTTGATGAATTAGGCACCCACATGAACACCACAAATCAGGACATTGTTTATCATTGTTGCTATGAATCCTATG
1681 AATGATCTTTTTTTTATTTTAAAGACCTACACTTAACCTACAAAACATTTGCTGTATAATTTGGTCAACAGTTTCTATCT
1761 ATCTGTATACTGTCATGATGTCTTAAACTGCAGGAGTTACATACTGAGTTTATATTTTTATTTGCTTTGAGCAAGGTAGA
1841 TAAACATTTTGGCCATTATAATGTGAAACCACTTCTTCTTTCTTTACAGTATTTGACCAAACTTGTGTGTCTATGATATT
1921 TGTAAATACATGCGAATATCTGTATTTCTTATCATAAGCCTATTTAGTTTTATTCTCAGTAGGGTTTTTTGGATTGTACA
2001 GTGTTTATATGATCTGAACTCCTTATACATAAGAAGGTGTGTATATTAATCCAATTATGGACTTAAAATATTTTAAAAGT
2081 ATAAATACCCTTATTTGCTGCAAAGACCAGTGTGTAGGCATTTGCTTTTTAGCAATATTTTTAAGTGCTCCATTTTAATG
2161 CCGAGGAATAAGTCTTTTGGCAACACAAACTGGTCAATAATAGGTAATGCAGGTATGTTCAGGTTAAGCCAACAATGTTT
2241 TGCATTTTTATGCTTATTTTCTGTCAACACTAATGAAGTCAACATTGCCTGAATGTCTGAATAATGAAACACATCCCTGT
2321 TTAAAAGTATGTAACTGAAAAAGAAATAAAAAAAAATAAAAGTAGTTTTTTTAAACTTGCTCTTTCCCATTTCCTCTAAA
2401 GATGGGTAAAATAATGTCACTCCCTAATTTAAGATAGGAATTATAAAAATTTGGTTTATTTAGTCTGTTATATATGAGAA
2481 GCAGAGCTAAAGGAATATGCTTTTGTTATTTTATGTTTTGTTTTGCTTTCTTGAAATCCAGTGGTAAAAAGCACACACTA
2561 GGAAGGATCTAAGCTTTCTTTAATATAAAAAAAATTATACTTCTCTGAACTGTTTAATAGAGCAATAATTAAATACATCT
2641 TCTGATAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugguUUCCGUCGGGACCGUUGa 5'
              ||| |  :::||||||| 
Target 5' gaatAAGTC--TTTTGGCAACa 3'
 2166 - 2185 150.00 -12.20
2 
miRNA  3' ugguuucCGUCGGGACCGUUga 5'
                 ||||   ||||||  
Target 5' ctgtgttGCAGAAGTGGCAAaa 3'
 697 - 718 131.00 -12.10
3 
miRNA  3' ugGUUU-CCGUCGGGACCGUUga 5'
            ||:| ||::|   |||:||  
Target 5' ggCAGATGGTGG---TGGTAAaa 3'
 617 - 636 117.00 -10.66
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30448736 4 COSMIC
COSN30457321 24 COSMIC
COSN30149488 25 COSMIC
COSN31500425 39 COSMIC
COSN31584819 42 COSMIC
COSN31547460 52 COSMIC
COSN31530568 65 COSMIC
COSN31536455 80 COSMIC
COSN30662569 83 COSMIC
COSN31533492 84 COSMIC
COSN30543483 101 COSMIC
COSN30474111 102 COSMIC
COSN30474152 103 COSMIC
COSN30188056 114 COSMIC
COSN31527486 115 COSMIC
COSN20466980 149 COSMIC
COSN30167812 159 COSMIC
COSN31537220 171 COSMIC
COSN30118939 177 COSMIC
COSN20101742 178 COSMIC
COSN31591693 284 COSMIC
COSN31528955 406 COSMIC
COSN9402773 459 COSMIC
COSN30169355 572 COSMIC
COSN31534105 604 COSMIC
COSN30161435 730 COSMIC
COSN31572055 798 COSMIC
COSN31517310 828 COSMIC
COSN24301294 854 COSMIC
COSN26603049 884 COSMIC
COSN31552521 988 COSMIC
COSN26566026 1025 COSMIC
COSN19603211 1071 COSMIC
COSN20101743 1218 COSMIC
COSN6860536 1219 COSMIC
COSN7861639 1502 COSMIC
COSN29728780 1527 COSMIC
COSN200405 1535 COSMIC
COSN31543340 1820 COSMIC
COSN31521210 1879 COSMIC
COSN16320890 1890 COSMIC
COSN31538080 1934 COSMIC
COSN25379242 1987 COSMIC
COSN31543329 2004 COSMIC
COSN30544433 2038 COSMIC
COSN26667916 2112 COSMIC
COSN6860537 2136 COSMIC
COSN26482243 2223 COSMIC
COSN31608896 2249 COSMIC
COSN24294918 2349 COSMIC
COSN16576743 2596 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs112383869 1 dbSNP
rs759272811 2 dbSNP
rs1242123379 3 dbSNP
rs764340855 4 dbSNP
rs1342560688 6 dbSNP
rs774832152 8 dbSNP
rs776563311 9 dbSNP
rs762301528 11 dbSNP
rs768014006 16 dbSNP
rs750456338 17 dbSNP
rs376283062 21 dbSNP
rs1336365681 34 dbSNP
rs766524676 36 dbSNP
rs753989505 37 dbSNP
rs1175996231 41 dbSNP
rs755286733 43 dbSNP
rs1339746044 44 dbSNP
rs1213944400 47 dbSNP
rs778569204 49 dbSNP
rs905960949 52 dbSNP
rs1233877954 56 dbSNP
rs370454717 57 dbSNP
rs1047733101 71 dbSNP
rs1001302621 75 dbSNP
rs1484291139 81 dbSNP
rs1484837910 82 dbSNP
rs372116190 84 dbSNP
rs1211635173 87 dbSNP
rs1350150308 88 dbSNP
rs35870673 88 dbSNP
rs1281991658 93 dbSNP
rs1223203350 99 dbSNP
rs1373777970 102 dbSNP
rs890574294 125 dbSNP
rs1445323581 126 dbSNP
rs994039724 130 dbSNP
rs1389823749 133 dbSNP
rs574456915 135 dbSNP
rs952446046 138 dbSNP
rs983816253 146 dbSNP
rs1018415784 149 dbSNP
rs1420842912 156 dbSNP
rs1400706002 157 dbSNP
rs146248944 160 dbSNP
rs749542016 161 dbSNP
rs1179369953 162 dbSNP
rs1275436075 165 dbSNP
rs199591283 165 dbSNP
rs201894090 165 dbSNP
rs369266560 165 dbSNP
rs560727281 171 dbSNP
rs1259104127 172 dbSNP
rs1360340319 176 dbSNP
rs976525738 177 dbSNP
rs541542202 178 dbSNP
rs1319447966 179 dbSNP
rs1362664630 180 dbSNP
rs1230334599 181 dbSNP
rs1297976036 182 dbSNP
rs1344050809 183 dbSNP
rs1217360500 184 dbSNP
rs1280693011 187 dbSNP
rs1313994463 191 dbSNP
rs923425670 192 dbSNP
rs546075128 196 dbSNP
rs750508908 201 dbSNP
rs1247628059 214 dbSNP
rs989024093 220 dbSNP
rs760759524 222 dbSNP
rs913493230 235 dbSNP
rs947348281 240 dbSNP
rs3797534 241 dbSNP
rs1477917064 246 dbSNP
rs1161917117 257 dbSNP
rs1171292124 258 dbSNP
rs1417667718 266 dbSNP
rs905885021 268 dbSNP
rs1427929876 271 dbSNP
rs1476330213 282 dbSNP
rs766862616 284 dbSNP
rs1009884191 286 dbSNP
rs1057180967 288 dbSNP
rs182326896 291 dbSNP
rs549827152 292 dbSNP
rs1025951705 293 dbSNP
rs186983831 300 dbSNP
rs1234713960 304 dbSNP
rs1305459117 310 dbSNP
rs1294436474 312 dbSNP
rs1214575871 315 dbSNP
rs1363468245 322 dbSNP
rs529205804 323 dbSNP
rs1005904533 326 dbSNP
rs927000308 329 dbSNP
rs1330259022 334 dbSNP
rs1327047785 338 dbSNP
rs1463364094 341 dbSNP
rs1170017225 344 dbSNP
rs1429141588 346 dbSNP
rs962576350 350 dbSNP
rs964083139 354 dbSNP
rs1468010514 366 dbSNP
rs1253374509 368 dbSNP
rs761940239 385 dbSNP
rs974289745 386 dbSNP
rs918521469 390 dbSNP
rs1479537678 392 dbSNP
rs1250353251 396 dbSNP
rs1204849728 402 dbSNP
rs1308744323 404 dbSNP
rs548091491 408 dbSNP
rs1300671902 414 dbSNP
rs1232709841 417 dbSNP
rs1029420866 418 dbSNP
rs929865817 420 dbSNP
rs1304846841 423 dbSNP
rs1388825175 425 dbSNP
rs1047785532 433 dbSNP
rs1276520295 444 dbSNP
rs911894658 450 dbSNP
rs1372452460 457 dbSNP
rs944822118 461 dbSNP
rs1368287557 463 dbSNP
rs1171906641 471 dbSNP
rs1224199292 473 dbSNP
rs1039129485 476 dbSNP
rs900548179 479 dbSNP
rs954826096 485 dbSNP
rs1395572408 487 dbSNP
rs988993067 488 dbSNP
rs17150513 500 dbSNP
rs1177394251 501 dbSNP
rs1481436822 505 dbSNP
rs968980410 511 dbSNP
rs561760963 512 dbSNP
rs1281601703 519 dbSNP
rs1236150600 523 dbSNP
rs1334351447 524 dbSNP
rs892069047 530 dbSNP
rs1306786650 531 dbSNP
rs1010440368 534 dbSNP
rs1023958148 537 dbSNP
rs1311328340 538 dbSNP
rs1434120192 544 dbSNP
rs1174241389 546 dbSNP
rs1451593285 547 dbSNP
rs971044599 552 dbSNP
rs115397951 555 dbSNP
rs1420684523 556 dbSNP
rs1451374439 558 dbSNP
rs572036943 560 dbSNP
rs537565164 561 dbSNP
rs1485707560 570 dbSNP
rs929785876 575 dbSNP
rs1046873996 582 dbSNP
rs1481014004 584 dbSNP
rs1182108192 585 dbSNP
rs973963415 586 dbSNP
rs1409066146 604 dbSNP
rs1458388750 608 dbSNP
rs918406573 611 dbSNP
rs951317299 617 dbSNP
rs372214518 618 dbSNP
rs1414466535 626 dbSNP
rs1356134787 628 dbSNP
rs556246891 629 dbSNP
rs1380623103 630 dbSNP
rs559271170 645 dbSNP
rs1159076140 646 dbSNP
rs1458562979 648 dbSNP
rs1415475965 649 dbSNP
rs944728801 652 dbSNP
rs1163758659 662 dbSNP
rs1039424952 663 dbSNP
rs780500620 664 dbSNP
rs1409074386 667 dbSNP
rs186369429 668 dbSNP
rs139157334 670 dbSNP
rs535433960 671 dbSNP
rs554549037 674 dbSNP
rs745383184 677 dbSNP
rs1010325704 680 dbSNP
rs1271706292 683 dbSNP
rs77141790 684 dbSNP
rs1335657068 685 dbSNP
rs907424693 687 dbSNP
rs1225245493 688 dbSNP
rs1325942629 690 dbSNP
rs1208296600 697 dbSNP
rs1318877367 700 dbSNP
rs1001221553 716 dbSNP
rs1034418566 717 dbSNP
rs190320211 720 dbSNP
rs1205024889 721 dbSNP
rs927541723 722 dbSNP
rs995254370 731 dbSNP
rs769496138 736 dbSNP
rs1165798778 737 dbSNP
rs1474762874 741 dbSNP
rs1373212326 748 dbSNP
rs115209096 749 dbSNP
rs1367524770 752 dbSNP
rs564584608 754 dbSNP
rs1019563219 760 dbSNP
rs1469190924 764 dbSNP
rs1164649995 767 dbSNP
rs964289572 770 dbSNP
rs576552759 776 dbSNP
rs974792276 780 dbSNP
rs182912897 781 dbSNP
rs1270890594 782 dbSNP
rs1428902217 788 dbSNP
rs1306072159 791 dbSNP
rs1368641540 802 dbSNP
rs936131706 803 dbSNP
rs1441280214 804 dbSNP
rs1372380897 808 dbSNP
rs561809068 808 dbSNP
rs1326437534 812 dbSNP
rs913279354 816 dbSNP
rs529291383 819 dbSNP
rs1059259 822 dbSNP
rs1045848133 826 dbSNP
rs796789844 829 dbSNP
rs541359063 831 dbSNP
rs1432357202 833 dbSNP
rs142461508 843 dbSNP
rs1193569738 852 dbSNP
rs1478552081 875 dbSNP
rs1248888373 879 dbSNP
rs369510768 880 dbSNP
rs1437513827 881 dbSNP
rs899763675 886 dbSNP
rs1055505292 891 dbSNP
rs111816091 892 dbSNP
rs1360582418 895 dbSNP
rs1279453589 897 dbSNP
rs995138131 907 dbSNP
rs570556354 914 dbSNP
rs768287650 915 dbSNP
rs1277602335 922 dbSNP
rs531492177 928 dbSNP
rs1196890838 936 dbSNP
rs886837063 940 dbSNP
rs868517987 942 dbSNP
rs1309480224 953 dbSNP
rs1412316995 958 dbSNP
rs774235697 960 dbSNP
rs549941476 961 dbSNP
rs1440214906 963 dbSNP
rs1189140220 964 dbSNP
rs1469975083 971 dbSNP
rs188793188 972 dbSNP
rs1032225256 978 dbSNP
rs1184634361 989 dbSNP
rs1484725781 994 dbSNP
rs535468579 995 dbSNP
rs1256947858 997 dbSNP
rs1210696101 999 dbSNP
rs1313830029 1003 dbSNP
rs1448619486 1006 dbSNP
rs1222928228 1008 dbSNP
rs1329619123 1008 dbSNP
rs1166557903 1009 dbSNP
rs1391791992 1014 dbSNP
rs1462385063 1019 dbSNP
rs1354236663 1022 dbSNP
rs968877400 1023 dbSNP
rs1302218660 1024 dbSNP
rs540720525 1035 dbSNP
rs1316856726 1037 dbSNP
rs1400437665 1045 dbSNP
rs1413239248 1047 dbSNP
rs1394405278 1050 dbSNP
rs957609490 1053 dbSNP
rs1161646680 1070 dbSNP
rs1034538415 1073 dbSNP
rs772357416 1080 dbSNP
rs1182476899 1082 dbSNP
rs1484277416 1084 dbSNP
rs1383879413 1090 dbSNP
rs990081409 1092 dbSNP
rs1215053067 1097 dbSNP
rs993068627 1110 dbSNP
rs1269826909 1113 dbSNP
rs1231054337 1117 dbSNP
rs1333644738 1119 dbSNP
rs773485263 1126 dbSNP
rs946116880 1133 dbSNP
rs1359275899 1135 dbSNP
rs1268925924 1139 dbSNP
rs1430731704 1140 dbSNP
rs1389810372 1144 dbSNP
rs1322908233 1146 dbSNP
rs1181545155 1157 dbSNP
rs1295770057 1158 dbSNP
rs1309646120 1170 dbSNP
rs1159666987 1190 dbSNP
rs1228731250 1193 dbSNP
rs1255949167 1194 dbSNP
rs149017033 1198 dbSNP
rs768405761 1198 dbSNP
rs778902309 1198 dbSNP
rs1450064316 1210 dbSNP
rs1249845474 1213 dbSNP
rs1342217099 1213 dbSNP
rs201124582 1216 dbSNP
rs74341911 1216 dbSNP
rs60579805 1218 dbSNP
rs1243358013 1219 dbSNP
rs868071753 1219 dbSNP
rs982846872 1222 dbSNP
rs1294283141 1226 dbSNP
rs1464112113 1228 dbSNP
rs1366503106 1231 dbSNP
rs937646803 1239 dbSNP
rs373042582 1246 dbSNP
rs1439083318 1257 dbSNP
rs1249617108 1259 dbSNP
rs909964505 1260 dbSNP
rs1459676442 1263 dbSNP
rs376546174 1274 dbSNP
rs1056451522 1276 dbSNP
rs115541717 1278 dbSNP
rs1430521672 1280 dbSNP
rs529449006 1281 dbSNP
rs930978375 1283 dbSNP
rs1046738655 1284 dbSNP
rs1192543106 1286 dbSNP
rs539764595 1289 dbSNP
rs1479484264 1291 dbSNP
rs1406927156 1306 dbSNP
rs886888990 1315 dbSNP
rs1007974950 1316 dbSNP
rs760735562 1325 dbSNP
rs11555299 1328 dbSNP
rs1205163660 1329 dbSNP
rs1343691881 1334 dbSNP
rs1248580455 1335 dbSNP
rs1232826162 1338 dbSNP
rs1051044212 1344 dbSNP
rs1302470113 1354 dbSNP
rs1388912565 1357 dbSNP
rs1371409034 1362 dbSNP
rs1307661929 1366 dbSNP
rs892136486 1369 dbSNP
rs1372556705 1372 dbSNP
rs945042311 1374 dbSNP
rs1434072692 1377 dbSNP
rs1329915054 1382 dbSNP
rs1377970227 1395 dbSNP
rs1043451681 1408 dbSNP
rs903617097 1411 dbSNP
rs558384963 1414 dbSNP
rs193056558 1418 dbSNP
rs1327894402 1431 dbSNP
rs1014455904 1447 dbSNP
rs1344863315 1450 dbSNP
rs1257130851 1452 dbSNP
rs185867851 1459 dbSNP
rs1315520851 1461 dbSNP
rs951379831 1465 dbSNP
rs1229316651 1486 dbSNP
rs983201977 1489 dbSNP
rs1311194328 1492 dbSNP
rs1395550981 1498 dbSNP
rs1402737094 1502 dbSNP
rs555489872 1506 dbSNP
rs1190466284 1507 dbSNP
rs1016996592 1518 dbSNP
rs1473396006 1520 dbSNP
rs202134645 1520 dbSNP
rs963100228 1520 dbSNP
rs1186555734 1533 dbSNP
rs1442502581 1536 dbSNP
rs921092194 1537 dbSNP
rs187571277 1559 dbSNP
rs766482451 1562 dbSNP
rs541062908 1569 dbSNP
rs1430015547 1578 dbSNP
rs1267942716 1579 dbSNP
rs11952411 1586 dbSNP
rs986679247 1590 dbSNP
rs533311055 1601 dbSNP
rs1043765363 1602 dbSNP
rs945036060 1602 dbSNP
rs1454615986 1603 dbSNP
rs903544996 1604 dbSNP
rs79845493 1611 dbSNP
rs796489149 1612 dbSNP
rs1320920677 1615 dbSNP
rs937748865 1617 dbSNP
rs1054839035 1627 dbSNP
rs765476750 1628 dbSNP
rs1391745843 1629 dbSNP
rs1407246676 1632 dbSNP
rs1284524223 1634 dbSNP
rs1162299946 1637 dbSNP
rs1472833507 1642 dbSNP
rs545788122 1655 dbSNP
rs1349304642 1664 dbSNP
rs564395907 1668 dbSNP
rs531583097 1670 dbSNP
rs1247977631 1674 dbSNP
rs1189572353 1677 dbSNP
rs771962465 1683 dbSNP
rs1466537564 1685 dbSNP
rs1271491096 1686 dbSNP
rs1357106380 1688 dbSNP
rs569181749 1688 dbSNP
rs887380644 1688 dbSNP
rs1317214557 1696 dbSNP
rs1004486756 1701 dbSNP
rs1017318848 1708 dbSNP
rs1220380065 1708 dbSNP
rs962749108 1710 dbSNP
rs996893332 1722 dbSNP
rs767264161 1728 dbSNP
rs1405638877 1738 dbSNP
rs1392237508 1742 dbSNP
rs1263395568 1745 dbSNP
rs955181285 1749 dbSNP
rs986658164 1753 dbSNP
rs149950949 1754 dbSNP
rs1223081402 1758 dbSNP
rs1245381193 1761 dbSNP
rs1251036725 1762 dbSNP
rs34866360 1774 dbSNP
rs1452354286 1793 dbSNP
rs1472290782 1844 dbSNP
rs1228117116 1854 dbSNP
rs1194080538 1856 dbSNP
rs1341562853 1860 dbSNP
rs1175612198 1863 dbSNP
rs967002467 1870 dbSNP
rs549977858 1873 dbSNP
rs979382472 1889 dbSNP
rs752593938 1893 dbSNP
rs1419836537 1897 dbSNP
rs1436964567 1898 dbSNP
rs924903087 1899 dbSNP
rs1367049231 1906 dbSNP
rs1426995925 1911 dbSNP
rs568192816 1914 dbSNP
rs1304258605 1917 dbSNP
rs1169744842 1925 dbSNP
rs1432224345 1928 dbSNP
rs1423712378 1930 dbSNP
rs1172319751 1934 dbSNP
rs1478563093 1935 dbSNP
rs937719506 1937 dbSNP
rs1054795403 1940 dbSNP
rs917695271 1942 dbSNP
rs1252680923 1953 dbSNP
rs1207189832 1954 dbSNP
rs529012057 1964 dbSNP
rs950201628 1968 dbSNP
rs1277874841 1974 dbSNP
rs1045852642 1986 dbSNP
rs1407450810 1997 dbSNP
rs1299323207 2001 dbSNP
rs1227441867 2002 dbSNP
rs1350541208 2007 dbSNP
rs1309263396 2010 dbSNP
rs1373443356 2012 dbSNP
rs191127691 2015 dbSNP
rs139453721 2016 dbSNP
rs539380062 2020 dbSNP
rs1361291776 2022 dbSNP
rs1415390749 2024 dbSNP
rs1246501070 2029 dbSNP
rs1427777762 2031 dbSNP
rs1157180548 2034 dbSNP
rs1472416033 2038 dbSNP
rs1413008007 2040 dbSNP
rs1184391731 2041 dbSNP
rs1273806587 2041 dbSNP
rs1482069895 2044 dbSNP
rs1471856162 2048 dbSNP
rs1236775550 2058 dbSNP
rs755589877 2059 dbSNP
rs898486563 2060 dbSNP
rs1266064050 2063 dbSNP
rs1481020253 2069 dbSNP
rs112012362 2073 dbSNP
rs996881875 2078 dbSNP
rs1028396560 2079 dbSNP
rs778791742 2100 dbSNP
rs955420561 2118 dbSNP
rs551830426 2136 dbSNP
rs1021174195 2137 dbSNP
rs779735076 2142 dbSNP
rs1164691078 2143 dbSNP
rs979756055 2150 dbSNP
rs925259013 2151 dbSNP
rs570329006 2153 dbSNP
rs1457075664 2160 dbSNP
rs1173187678 2163 dbSNP
rs373955333 2164 dbSNP
rs537276056 2167 dbSNP
rs990470292 2172 dbSNP
rs1182351730 2175 dbSNP
rs917600646 2182 dbSNP
rs1300692168 2189 dbSNP
rs879253498 2195 dbSNP
rs1046749 2198 dbSNP
rs1269613452 2199 dbSNP
rs1047480268 2201 dbSNP
rs1320559455 2202 dbSNP
rs908663901 2203 dbSNP
rs940240819 2206 dbSNP
rs1039017328 2210 dbSNP
rs898775018 2214 dbSNP
rs997122344 2216 dbSNP
rs1366453576 2230 dbSNP
rs1453092855 2233 dbSNP
rs1456624573 2237 dbSNP
rs756257726 2238 dbSNP
rs1049730891 2243 dbSNP
rs1165518538 2250 dbSNP
rs1407157746 2251 dbSNP
rs1388184031 2254 dbSNP
rs1167947103 2271 dbSNP
rs1296511695 2274 dbSNP
rs1249705184 2283 dbSNP
rs183633552 2284 dbSNP
rs1339834043 2285 dbSNP
rs1216217176 2290 dbSNP
rs1189080529 2310 dbSNP
rs1487927142 2312 dbSNP
rs573862983 2316 dbSNP
rs1223045241 2321 dbSNP
rs1339471930 2323 dbSNP
rs1308129684 2336 dbSNP
rs1209584214 2338 dbSNP
rs1241530812 2344 dbSNP
rs1008277683 2347 dbSNP
rs1021079527 2348 dbSNP
rs1298117526 2348 dbSNP
rs1406831156 2348 dbSNP
rs902337215 2348 dbSNP
rs1000734492 2349 dbSNP
rs1247740708 2357 dbSNP
rs1474647486 2363 dbSNP
rs1188767481 2373 dbSNP
rs1391976455 2380 dbSNP
rs377397864 2383 dbSNP
rs1425367844 2389 dbSNP
rs1040925334 2395 dbSNP
rs1481786607 2403 dbSNP
rs1250488708 2405 dbSNP
rs1205277085 2406 dbSNP
rs1032654863 2415 dbSNP
rs1231445407 2428 dbSNP
rs754951356 2436 dbSNP
rs1302239981 2441 dbSNP
rs959257792 2451 dbSNP
rs1225625183 2455 dbSNP
rs899668982 2456 dbSNP
rs1307447651 2475 dbSNP
rs1410550258 2477 dbSNP
rs1398465028 2482 dbSNP
rs553390398 2483 dbSNP
rs1465350712 2484 dbSNP
rs1413396212 2500 dbSNP
rs1173719678 2505 dbSNP
rs1032687474 2506 dbSNP
rs990710363 2511 dbSNP
rs1410805271 2521 dbSNP
rs1182182909 2534 dbSNP
rs149673281 2537 dbSNP
rs970368829 2540 dbSNP
rs1011557089 2555 dbSNP
rs1483110631 2574 dbSNP
rs983601821 2581 dbSNP
rs1020229138 2587 dbSNP
rs757268464 2587 dbSNP
rs974289286 2587 dbSNP
rs967468821 2588 dbSNP
rs1310483896 2595 dbSNP
rs1395429055 2596 dbSNP
rs1379828195 2598 dbSNP
rs981930089 2600 dbSNP
rs1455445725 2601 dbSNP
rs928696647 2604 dbSNP
rs920107258 2608 dbSNP
rs1454888964 2609 dbSNP
rs1432696170 2612 dbSNP
rs1366245775 2623 dbSNP
rs932857932 2626 dbSNP
rs530441952 2630 dbSNP
rs545382849 2634 dbSNP
rs564251341 2642 dbSNP
rs1261276494 2646 dbSNP
rs188436651 2649 dbSNP
rs773389190 2653 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugguuuccgucggGACC-GUUGa 5'
                       |||| |||: 
Target 5' ----caacacaaaCUGGUCAAUa 3'
 		1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 1456.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugguuuccgucggGACC-GUUGa 5'
                       |||| |||: 
Target 5' ----caacacaaaCUGGUCAAUa 3'
 		1 - 19
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000360683.2 | 3UTR | CAACACAAACUGGUCAAUAAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000360683.2 | 3UTR | CAACACAAACUGGUCAAUAAUAGGUAAUGCAGGUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
167 hsa-miR-6501-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT156859 FAM126B family with sequence similarity 126 member B 2 2
MIRT173355 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT369102 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT442037 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT442829 AZIN1 antizyme inhibitor 1 2 2
MIRT443729 CCND2 cyclin D2 2 2
MIRT453771 NUCB1 nucleobindin 1 2 10
MIRT453875 IFRD1 interferon related developmental regulator 1 2 12
MIRT454229 OSBPL10 oxysterol binding protein like 10 2 11
MIRT458829 RPUSD2 RNA pseudouridylate synthase domain containing 2 2 2
MIRT459898 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 10
MIRT464162 VMP1 vacuole membrane protein 1 2 15
MIRT495411 SMAD2 SMAD family member 2 2 2
MIRT496906 TRIM56 tripartite motif containing 56 2 2
MIRT498653 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 6
MIRT498706 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 10
MIRT499308 ZNF485 zinc finger protein 485 2 6
MIRT499707 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 10
MIRT499755 CIRH1A UTP4, small subunit processome component 2 6
MIRT499827 PCSK9 proprotein convertase subtilisin/kexin type 9 2 8
MIRT503691 MAVS mitochondrial antiviral signaling protein 2 2
MIRT512418 LAYN layilin 2 4
MIRT516232 RAB3B RAB3B, member RAS oncogene family 2 2
MIRT522554 MCAM melanoma cell adhesion molecule 2 4
MIRT523760 FBXO27 F-box protein 27 2 4
MIRT525107 PRKD2 protein kinase D2 2 2
MIRT525919 KIAA0391 KIAA0391 2 2
MIRT527246 COMMD6 COMM domain containing 6 2 2
MIRT527564 ADCY7 adenylate cyclase 7 2 2
MIRT528764 CD1D CD1d molecule 2 2
MIRT529362 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT529464 ZNF546 zinc finger protein 546 2 2
MIRT530676 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531635 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531909 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532172 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT534234 SLC25A16 solute carrier family 25 member 16 2 4
MIRT534561 RRAGD Ras related GTP binding D 2 2
MIRT534971 PSD3 pleckstrin and Sec7 domain containing 3 2 2
MIRT536738 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT538544 CELF1 CUGBP Elav-like family member 1 2 2
MIRT540462 ZNF71 zinc finger protein 71 2 2
MIRT540554 PPIC peptidylprolyl isomerase C 2 2
MIRT543593 KIAA1549 KIAA1549 2 2
MIRT543963 RNF20 ring finger protein 20 2 2
MIRT544047 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT544670 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT550665 TRAF1 TNF receptor associated factor 1 2 2
MIRT558540 CSNK1G3 casein kinase 1 gamma 3 2 4
MIRT574917 Vmp1 vacuole membrane protein 1 2 9
MIRT575298 Osbpl10 oxysterol binding protein-like 10 2 7
MIRT607960 SNX22 sorting nexin 22 2 2
MIRT610649 TIPRL TOR signaling pathway regulator 2 8
MIRT615899 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT617438 CCS copper chaperone for superoxide dismutase 2 2
MIRT617510 C5orf45 MRN complex interacting protein 2 2
MIRT617548 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT620565 WBSCR27 methyltransferase like 27 2 2
MIRT623166 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624161 DGKE diacylglycerol kinase epsilon 2 2
MIRT626090 MKLN1 muskelin 1 2 2
MIRT627010 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627073 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627136 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627340 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627436 TAS2R5 taste 2 receptor member 5 2 2
MIRT628273 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629091 F2RL1 F2R like trypsin receptor 1 2 4
MIRT629282 UNC13A unc-13 homolog A 2 2
MIRT630122 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630247 SMTNL2 smoothelin like 2 2 2
MIRT631260 CENPM centromere protein M 2 2
MIRT631336 CD300E CD300e molecule 2 2
MIRT631399 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632593 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632991 DUSP18 dual specificity phosphatase 18 2 2
MIRT633079 CXorf21 chromosome X open reading frame 21 2 2
MIRT634223 TMEM132B transmembrane protein 132B 2 2
MIRT635046 MYH11 myosin heavy chain 11 2 2
MIRT636444 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636649 CDK4 cyclin dependent kinase 4 2 2
MIRT637129 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637282 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637527 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637783 OLA1 Obg like ATPase 1 2 2
MIRT637920 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638238 SLC1A5 solute carrier family 1 member 5 2 2
MIRT638444 PLXDC2 plexin domain containing 2 2 2
MIRT639765 GPR45 G protein-coupled receptor 45 2 2
MIRT640437 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT643006 ZNF829 zinc finger protein 829 2 2
MIRT644233 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644661 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT644957 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT645086 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645256 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT645861 GBP6 guanylate binding protein family member 6 2 2
MIRT645987 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646502 FAM217B family with sequence similarity 217 member B 2 2
MIRT646811 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT647706 NFX1 nuclear transcription factor, X-box binding 1 2 2
MIRT649657 TEP1 telomerase associated protein 1 2 2
MIRT650550 YIPF4 Yip1 domain family member 4 2 2
MIRT650785 GSR glutathione-disulfide reductase 2 2
MIRT651461 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652098 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT654117 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT658901 DPY19L4 dpy-19 like 4 2 2
MIRT659370 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT662537 MTAP methylthioadenosine phosphorylase 2 2
MIRT662617 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT663491 IYD iodotyrosine deiodinase 2 2
MIRT663899 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT664552 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT664582 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT664953 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT665193 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665446 WDR17 WD repeat domain 17 2 2
MIRT665894 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT666480 SBNO1 strawberry notch homolog 1 2 2
MIRT666514 RNF170 ring finger protein 170 2 2
MIRT666692 RBM23 RNA binding motif protein 23 2 2
MIRT666791 PSMD1 proteasome 26S subunit, non-ATPase 1 2 2
MIRT667453 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT667553 LRAT lecithin retinol acyltransferase 2 4
MIRT667744 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668080 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668114 GK5 glycerol kinase 5 (putative) 2 2
MIRT668501 ESYT2 extended synaptotagmin 2 2 2
MIRT668942 CNKSR3 CNKSR family member 3 2 2
MIRT670408 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT671134 CD226 CD226 molecule 2 2
MIRT671919 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672287 GP2 glycoprotein 2 2 2
MIRT672427 POLR2D RNA polymerase II subunit D 2 2
MIRT672762 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672923 LRRC2 leucine rich repeat containing 2 2 2
MIRT673150 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673309 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT673560 PLA2G16 phospholipase A2 group XVI 2 2
MIRT673895 DCTN6 dynactin subunit 6 2 2
MIRT674513 PRR23A proline rich 23A 2 2
MIRT674614 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT674747 SLC16A1 solute carrier family 16 member 1 2 2
MIRT675693 PIWIL1 piwi like RNA-mediated gene silencing 1 2 2
MIRT675890 SNAP29 synaptosome associated protein 29 2 2
MIRT685271 KIAA1143 KIAA1143 2 2
MIRT686057 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT693886 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT695594 TMEM199 transmembrane protein 199 2 2
MIRT696592 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT698041 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT699907 RUNDC1 RUN domain containing 1 2 2
MIRT706608 CYB5B cytochrome b5 type B 2 2
MIRT706628 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT706640 NCBP2 nuclear cap binding protein subunit 2 2 2
MIRT706676 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706723 RFK riboflavin kinase 2 2
MIRT706857 MAFF MAF bZIP transcription factor F 2 2
MIRT706891 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706958 FANCC Fanconi anemia complementation group C 2 2
MIRT706976 XPO5 exportin 5 2 2
MIRT707010 RRP36 ribosomal RNA processing 36 2 2
MIRT707028 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707068 MED29 mediator complex subunit 29 2 2
MIRT713253 ZFP30 ZFP30 zinc finger protein 2 2
MIRT719130 NR2F6 nuclear receptor subfamily 2 group F member 6 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6501 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-6501 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6501-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-6501-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-6501-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6501-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-6501-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6501-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-6501-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission