>COX6B1|NM_001863|3'UTR
   1 ACTGGCTGCATCTCCCTTTCCTCTGTCCTCCATCCTTCTCCCAGGATGGTGAAGGGGGACCTGGTACCCAGTGATCCCCA
  81 CCCCAGGATCCTAAATCATGACTTACCTGCTAATAAAAACTCATTGGAAAAGTGAGA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' acucuguccaaguacGACGAUa 5' |||||| Target 5' taaatcatgacttacCTGCTAa 3'	92 - 113	120.00	-8.50
2	miRNA 3' acucuguccaaguaCGACGaua 5' ||||| Target 5' ----------actgGCTGCatc 3'	1 - 12	100.00	-6.50
3	miRNA 3' acucuguccaaguacGACGAUa 5' ||| || Target 5' atggtgaagggggacCTGGTAc 3'	46 - 67	88.00	-7.33

Mutant ID	Mutant Position	Mutant Source
COSN30509186	17	COSMIC
COSN30485768	21	COSMIC
COSN30100407	35	COSMIC
COSN30492052	36	COSMIC
COSN31497035	101	COSMIC
COSN22794383	105	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs138005677	3	dbSNP
rs921151956	5	dbSNP
rs776141575	7	dbSNP
rs763306735	9	dbSNP
rs769120723	14	dbSNP
rs774572610	15	dbSNP
rs761578251	16	dbSNP
rs14988	20	dbSNP
rs372163838	21	dbSNP
rs767181711	28	dbSNP
rs750042563	38	dbSNP
rs760185777	39	dbSNP
rs201262461	49	dbSNP
rs933919894	57	dbSNP
rs986602536	59	dbSNP
rs1168827908	61	dbSNP
rs577937635	62	dbSNP
rs1399760488	65	dbSNP
rs908361580	71	dbSNP
rs1478004509	76	dbSNP
rs1425721414	77	dbSNP
rs1196735994	99	dbSNP
rs1459176327	100	dbSNP
rs1005913730	110	dbSNP
rs939875281	114	dbSNP
rs1038119180	121	dbSNP
rs1256951707	122	dbSNP
rs898246852	125	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.