miRTarBase - #MIRT558784


—
pre-miRNA Information
pre-miRNA hsa-mir-6511b-1   
Genomic Coordinates chr16: 2106669 - 2106753
Description Homo sapiens miR-6511b-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-6511b-2   
Genomic Coordinates chr16: 15134075 - 15134145
Description Homo sapiens miR-6511b-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6511b-3p
Sequence 53| CCUCACCACCCCUUCUGCCUGCA |75
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
993639 5 ClinVar
1196654 15 ClinVar
256998 15 ClinVar
433980 16 ClinVar
586295 18 ClinVar
433979 19 ClinVar
COSM3948368 17 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs769351879 1 dbSNP
rs1001283562 2 dbSNP
rs763611191 3 dbSNP
rs1465530682 4 dbSNP
rs1227492873 4 dbSNP
rs745502224 5 dbSNP
rs551972801 6 dbSNP
rs538162642 6 dbSNP
rs751438298 7 dbSNP
rs1285683081 7 dbSNP
rs1340898267 8 dbSNP
rs4018164 9 dbSNP
rs370568831 9 dbSNP
rs1180919709 10 dbSNP
rs1339482497 10 dbSNP
rs758216756 11 dbSNP
rs1323026290 11 dbSNP
rs1239445091 12 dbSNP
rs1310601001 12 dbSNP
rs1431093969 13 dbSNP
rs752690118 15 dbSNP
rs1371790714 15 dbSNP
rs746463189 16 dbSNP
rs1209415208 17 dbSNP
rs761022804 17 dbSNP
rs1242038386 17 dbSNP
rs370411414 18 dbSNP
rs759723934 19 dbSNP
rs1428318191 19 dbSNP
rs1416441031 20 dbSNP
rs754040914 21 dbSNP
rs776062795 21 dbSNP
rs1273686335 22 dbSNP
rs1182772456 22 dbSNP
rs1472619959 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CEP55   
Synonyms C10orf3, CT111, URCC6
Description centrosomal protein 55
Transcript NM_001127182   
Other Transcripts NM_018131   
Expression
Putative miRNA Targets on CEP55
3'UTR of CEP55
(miRNA target sites are highlighted)		 
>CEP55|NM_001127182|3'UTR
   1 CAAAATAAGTATTTGTTTTGATATTAAAAGATTCAATACTGTATTTTCTGTTAGCTTGTGGGCATTTTGAATTATATATT
  81 TCACATTTTGCATAAAACTGCCTATCTACCTTTGACACTCCAGCATGCTAGTGAATCATGTATCTTTTAGGCTGCTGTGC
 161 ATTTCTCTTGGCAGTGATACCTCCCTGACATGGTTCATCATCAGGCTGCAATGACAGAATGTGGTGAGCAGCGTCTACTG
 241 AGACTACTAACATTTTGCACTGTCAAAATACTTGGTGAGGAAAAGATAGCTCAGGTTATTGCTAATGGGTTAATGCACCA
 321 GCAAGCAAAATATTTTATGTTTTGGGGGTTTTGAAAAATCAAAGATAATTAACCAAGGATCTTAACTGTGTTCGCATTTT
 401 TTATCCAAGCACTTAGAAAACCTACAATCCTAATTTTGATGTCCATTGTTAAGAGGTGGTGATAGATACTATTTTTTTTT
 481 TCATATTGTATAGCGGTTATTAGAAAAGTTGGGGATTTTCTTGATCTTTATTGCTGCTTACCATTGAAACTTAACCCAGC
 561 TGTGTTCCCCAACTCTGTTCTGCGCACGAAACAGTATCTGTTTGAGGCATAATCTTAAGTGGCCACACACAATGTTTTCT
 641 CTTATGTTATCTGGCAGTAACTGTAACTTGAATTACATTAGCACATTCTGCTTAGCTAAAATTGTTAAAATAAACTTTAA
 721 TAAACCCATGTAGCCCTCTCATTTGATTGACAGTATTTTAGTTATTTTTGGCATTCTTAAAGCTGGGCAATGTAATGATC
 801 AGATCTTTGTTTGTCTGAACAGGTATTTTTATACATGCTTTTTGTAAACCAAAAACTTTTAAATTTCTTCAGGTTTTCTA
 881 ACATGCTTACCACTGGGCTACTGTAAATGAGAAAAGAATAAAATTATTTAATGTTTTAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acguCCGUCUUCCCCACCACUCc 5'
              | |||||   |||||||| 
Target 5' caatGACAGAA--TGTGGTGAGc 3'
 209 - 229 159.00 -17.10
2 
miRNA  3' acGUCCGUCUUCCCCACCACUCc 5'
            | | || ||    ||||||| 
Target 5' caCTGTCAAAATACTTGGTGAGg 3'
 258 - 280 149.00 -13.54
3 
miRNA  3' acguccgucUUCCCCACCACUcc 5'
                   ||| ||||||||  
Target 5' tccattgttAAGAGGTGGTGAta 3'
 442 - 464 142.00 -13.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31580282 10 COSMIC
COSN30116664 20 COSMIC
COSN5293729 32 COSMIC
COSN31559862 88 COSMIC
COSN1507337 232 COSMIC
COSN20107393 353 COSMIC
COSN1507338 526 COSMIC
COSN24266314 910 COSMIC
COSN5889592 929 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1028668062 2 dbSNP
rs376713552 10 dbSNP
rs760563203 10 dbSNP
rs369071979 12 dbSNP
rs1211983142 16 dbSNP
rs1260245458 36 dbSNP
rs1474474428 37 dbSNP
rs1179589907 38 dbSNP
rs1187854963 40 dbSNP
rs755379142 41 dbSNP
rs560507013 42 dbSNP
rs1253863908 49 dbSNP
rs1227080551 67 dbSNP
rs968202669 75 dbSNP
rs1235196746 77 dbSNP
rs544562270 79 dbSNP
rs1305970680 87 dbSNP
rs900048835 92 dbSNP
rs1378938859 93 dbSNP
rs574084114 109 dbSNP
rs1466184850 113 dbSNP
rs1401812308 115 dbSNP
rs1209740651 117 dbSNP
rs1467730349 123 dbSNP
rs1378587508 140 dbSNP
rs1178339745 141 dbSNP
rs1438458073 161 dbSNP
rs1240559898 168 dbSNP
rs1178768346 172 dbSNP
rs1254506412 174 dbSNP
rs554798269 182 dbSNP
rs1481717075 191 dbSNP
rs1441304479 194 dbSNP
rs1196459540 197 dbSNP
rs1201850719 200 dbSNP
rs992748106 200 dbSNP
rs1051511803 206 dbSNP
rs770861276 212 dbSNP
rs918134214 215 dbSNP
rs1237684310 228 dbSNP
rs1355826216 232 dbSNP
rs1309846084 233 dbSNP
rs969614202 234 dbSNP
rs111293847 244 dbSNP
rs772620389 244 dbSNP
rs1332210737 247 dbSNP
rs1431210482 257 dbSNP
rs1433583089 258 dbSNP
rs1175046966 260 dbSNP
rs1403174329 261 dbSNP
rs980735946 263 dbSNP
rs776571066 271 dbSNP
rs543160106 272 dbSNP
rs1382744792 280 dbSNP
rs1463150092 281 dbSNP
rs186840462 286 dbSNP
rs1366221986 288 dbSNP
rs75712754 293 dbSNP
rs34087318 307 dbSNP
rs1442713588 315 dbSNP
rs1262007534 319 dbSNP
rs908639455 320 dbSNP
rs1002441386 323 dbSNP
rs35067961 326 dbSNP
rs1286398310 337 dbSNP
rs940508657 338 dbSNP
rs1354086301 339 dbSNP
rs1282565314 345 dbSNP
rs1030416457 347 dbSNP
rs370079649 349 dbSNP
rs3834415 349 dbSNP
rs552052805 349 dbSNP
rs200560574 350 dbSNP
rs12779614 353 dbSNP
rs771876020 361 dbSNP
rs901724369 368 dbSNP
rs1219041841 370 dbSNP
rs1299558995 375 dbSNP
rs559622627 378 dbSNP
rs1020855695 380 dbSNP
rs1319330269 388 dbSNP
rs12245643 395 dbSNP
rs1389203656 407 dbSNP
rs1164556261 408 dbSNP
rs1472821411 426 dbSNP
rs1422407845 428 dbSNP
rs1050073562 430 dbSNP
rs1191088203 431 dbSNP
rs1478562639 438 dbSNP
rs1263637539 445 dbSNP
rs1220550550 449 dbSNP
rs1449850680 454 dbSNP
rs1291908627 460 dbSNP
rs1211755454 466 dbSNP
rs1229391185 467 dbSNP
rs140828289 472 dbSNP
rs547824055 472 dbSNP
rs979105238 472 dbSNP
rs1274095262 483 dbSNP
rs1482094694 484 dbSNP
rs1202992773 486 dbSNP
rs12245717 489 dbSNP
rs975948291 493 dbSNP
rs921461189 495 dbSNP
rs1190424643 496 dbSNP
rs536647524 497 dbSNP
rs550329956 498 dbSNP
rs191623783 505 dbSNP
rs542866649 509 dbSNP
rs1423877963 512 dbSNP
rs956668041 515 dbSNP
rs1013667592 521 dbSNP
rs764332748 524 dbSNP
rs1476901666 526 dbSNP
rs183868661 536 dbSNP
rs774734037 541 dbSNP
rs1038416498 543 dbSNP
rs145548789 551 dbSNP
rs1002308265 557 dbSNP
rs1196829631 558 dbSNP
rs1350978413 559 dbSNP
rs1436313509 560 dbSNP
rs1320348869 563 dbSNP
rs919903881 564 dbSNP
rs1218824719 570 dbSNP
rs572706896 572 dbSNP
rs1364516294 576 dbSNP
rs762103787 584 dbSNP
rs746630554 585 dbSNP
rs1328757743 586 dbSNP
rs1448319302 588 dbSNP
rs908592615 594 dbSNP
rs768006824 605 dbSNP
rs535024318 623 dbSNP
rs1248274350 633 dbSNP
rs1020821418 635 dbSNP
rs1290615586 641 dbSNP
rs975913620 645 dbSNP
rs375737489 646 dbSNP
rs931866303 657 dbSNP
rs1220738706 664 dbSNP
rs964787990 665 dbSNP
rs1244805433 675 dbSNP
rs1459124986 685 dbSNP
rs1233476507 706 dbSNP
rs1050308685 715 dbSNP
rs1310591207 718 dbSNP
rs41290214 725 dbSNP
rs1371184015 728 dbSNP
rs574122915 729 dbSNP
rs1307667579 730 dbSNP
rs1449603877 745 dbSNP
rs1373457595 759 dbSNP
rs542999367 760 dbSNP
rs986999595 779 dbSNP
rs188965147 784 dbSNP
rs1164506703 793 dbSNP
rs892211531 797 dbSNP
rs778926169 806 dbSNP
rs1013322787 807 dbSNP
rs1160405356 818 dbSNP
rs1419540193 819 dbSNP
rs189688979 830 dbSNP
rs1025084687 844 dbSNP
rs1181345270 850 dbSNP
rs1405361506 857 dbSNP
rs1482432731 857 dbSNP
rs116816457 859 dbSNP
rs1347361295 860 dbSNP
rs186932514 874 dbSNP
rs1242971073 878 dbSNP
rs938035190 881 dbSNP
rs1311474282 890 dbSNP
rs1226107083 896 dbSNP
rs528288559 898 dbSNP
rs1293498691 905 dbSNP
rs953086488 910 dbSNP
rs1398967517 915 dbSNP
rs1363308522 917 dbSNP
rs1358402892 918 dbSNP
rs1299734918 929 dbSNP
rs1454772385 937 dbSNP
rs1349214546 938 dbSNP
rs896599054 940 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55165.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000371485.3 | 3UTR | UCUACUGAGACUACUAACAUUUUGCACUGUCAAAAUACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-6511b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059269 CELF1 CUGBP Elav-like family member 1 2 2
MIRT061287 IPO7 importin 7 2 2
MIRT115533 MAZ MYC associated zinc finger protein 2 2
MIRT345986 BIRC5 baculoviral IAP repeat containing 5 2 8
MIRT379536 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 2
MIRT442491 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 2 8
MIRT443701 HUNK hormonally up-regulated Neu-associated kinase 2 4
MIRT459167 HSPA6 heat shock protein family A (Hsp70) member 6 2 21
MIRT497179 ZBTB40 zinc finger and BTB domain containing 40 2 2
MIRT497846 GATA6 GATA binding protein 6 2 4
MIRT519625 ZNF781 zinc finger protein 781 2 2
MIRT519838 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT528560 DNAAF3 dynein axonemal assembly factor 3 2 2
MIRT530718 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT530810 GPR182 G protein-coupled receptor 182 2 2
MIRT533265 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT533726 TMEM246 transmembrane protein 246 2 2
MIRT535547 P2RY2 purinergic receptor P2Y2 2 2
MIRT536019 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT539494 ACTN4 actinin alpha 4 2 2
MIRT541793 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 2 8
MIRT554509 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT558784 CEP55 centrosomal protein 55 2 2
MIRT560013 ZNF525 zinc finger protein 525 2 2
MIRT560078 ZNF195 zinc finger protein 195 2 2
MIRT570135 IL1RL2 interleukin 1 receptor like 2 2 2
MIRT570890 ZNF780A zinc finger protein 780A 2 2
MIRT607972 SNX22 sorting nexin 22 2 2
MIRT608104 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT610471 ADAMTS13 ADAM metallopeptidase with thrombospondin type 1 motif 13 2 4
MIRT611134 GGT7 gamma-glutamyltransferase 7 2 2
MIRT611448 NRIP3 nuclear receptor interacting protein 3 2 2
MIRT613019 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT615753 C6 complement C6 2 2
MIRT620464 CERS6 ceramide synthase 6 2 2
MIRT632248 VPS41 VPS41, HOPS complex subunit 2 2
MIRT636099 ZDHHC22 zinc finger DHHC-type containing 22 2 2
MIRT637452 ZNF324B zinc finger protein 324B 2 2
MIRT638927 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT646768 WDR3 WD repeat domain 3 2 2
MIRT652610 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT652868 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT653655 SLC27A4 solute carrier family 27 member 4 2 2
MIRT657089 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT657884 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT662919 MED18 mediator complex subunit 18 2 2
MIRT685622 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT687427 NRIP1 nuclear receptor interacting protein 1 2 2
MIRT692304 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT695127 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695144 PRY PTPN13-like, Y-linked 2 2
MIRT696286 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT699350 SLC35E1 solute carrier family 35 member E1 2 2
MIRT709901 AGO1 argonaute 1, RISC catalytic component 2 2
MIRT710877 SLC25A42 solute carrier family 25 member 42 2 2
MIRT711365 MED7 mediator complex subunit 7 2 2
MIRT711444 FRMPD3 FERM and PDZ domain containing 3 2 2
MIRT713221 RCAN2 regulator of calcineurin 2 2 2
MIRT713281 LAIR1 leukocyte associated immunoglobulin like receptor 1 2 2
MIRT714195 TRAF7 TNF receptor associated factor 7 2 2
MIRT715152 IL12B interleukin 12B 2 2
MIRT719197 CASP10 caspase 10 2 2
MIRT719469 SRF serum response factor 2 2
MIRT720197 MPP6 membrane palmitoylated protein 6 2 2
MIRT720449 SLC16A5 solute carrier family 16 member 5 2 2
MIRT720461 RAB31 RAB31, member RAS oncogene family 2 2
MIRT721646 ZNF207 zinc finger protein 207 2 2
MIRT722001 CLLU1OS chronic lymphocytic leukemia up-regulated 1 opposite strand 2 2
MIRT725521 FAM229B family with sequence similarity 229 member B 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6511b-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-6511b-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-6511b-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-6511b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6511b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-6511b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission