pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6511b-1 |
Genomic Coordinates | chr16: 2106669 - 2106753 |
Description | Homo sapiens miR-6511b-1 stem-loop |
Comment | None |
RNA Secondary Structure | |
pre-miRNA | hsa-mir-6511b-2 |
Genomic Coordinates | chr16: 15134075 - 15134145 |
Description | Homo sapiens miR-6511b-2 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6511b-3p | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence | 53| CCUCACCACCCCUUCUGCCUGCA |75 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CEP55 | ||||||||||||||||||||
Synonyms | C10orf3, CT111, URCC6 | ||||||||||||||||||||
Description | centrosomal protein 55 | ||||||||||||||||||||
Transcript | NM_001127182 | ||||||||||||||||||||
Other Transcripts | NM_018131 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CEP55 | |||||||||||||||||||||
3'UTR of CEP55 (miRNA target sites are highlighted) |
>CEP55|NM_001127182|3'UTR 1 CAAAATAAGTATTTGTTTTGATATTAAAAGATTCAATACTGTATTTTCTGTTAGCTTGTGGGCATTTTGAATTATATATT 81 TCACATTTTGCATAAAACTGCCTATCTACCTTTGACACTCCAGCATGCTAGTGAATCATGTATCTTTTAGGCTGCTGTGC 161 ATTTCTCTTGGCAGTGATACCTCCCTGACATGGTTCATCATCAGGCTGCAATGACAGAATGTGGTGAGCAGCGTCTACTG 241 AGACTACTAACATTTTGCACTGTCAAAATACTTGGTGAGGAAAAGATAGCTCAGGTTATTGCTAATGGGTTAATGCACCA 321 GCAAGCAAAATATTTTATGTTTTGGGGGTTTTGAAAAATCAAAGATAATTAACCAAGGATCTTAACTGTGTTCGCATTTT 401 TTATCCAAGCACTTAGAAAACCTACAATCCTAATTTTGATGTCCATTGTTAAGAGGTGGTGATAGATACTATTTTTTTTT 481 TCATATTGTATAGCGGTTATTAGAAAAGTTGGGGATTTTCTTGATCTTTATTGCTGCTTACCATTGAAACTTAACCCAGC 561 TGTGTTCCCCAACTCTGTTCTGCGCACGAAACAGTATCTGTTTGAGGCATAATCTTAAGTGGCCACACACAATGTTTTCT 641 CTTATGTTATCTGGCAGTAACTGTAACTTGAATTACATTAGCACATTCTGCTTAGCTAAAATTGTTAAAATAAACTTTAA 721 TAAACCCATGTAGCCCTCTCATTTGATTGACAGTATTTTAGTTATTTTTGGCATTCTTAAAGCTGGGCAATGTAATGATC 801 AGATCTTTGTTTGTCTGAACAGGTATTTTTATACATGCTTTTTGTAAACCAAAAACTTTTAAATTTCTTCAGGTTTTCTA 881 ACATGCTTACCACTGGGCTACTGTAAATGAGAAAAGAATAAAATTATTTAATGTTTTAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 55165.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000371485.3 | 3UTR | UCUACUGAGACUACUAACAUUUUGCACUGUCAAAAUACUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
69 hsa-miR-6511b-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT059269 | CELF1 | CUGBP Elav-like family member 1 | 2 | 2 | ||||||||
MIRT061287 | IPO7 | importin 7 | 2 | 2 | ||||||||
MIRT115533 | MAZ | MYC associated zinc finger protein | 2 | 2 | ||||||||
MIRT345986 | BIRC5 | baculoviral IAP repeat containing 5 | 2 | 8 | ||||||||
MIRT379536 | HNRNPK | heterogeneous nuclear ribonucleoprotein K | 2 | 2 | ||||||||
MIRT442491 | RBBP5 | RB binding protein 5, histone lysine methyltransferase complex subunit | 2 | 8 | ||||||||
MIRT443701 | HUNK | hormonally up-regulated Neu-associated kinase | 2 | 4 | ||||||||
MIRT459167 | HSPA6 | heat shock protein family A (Hsp70) member 6 | 2 | 21 | ||||||||
MIRT497179 | ZBTB40 | zinc finger and BTB domain containing 40 | 2 | 2 | ||||||||
MIRT497846 | GATA6 | GATA binding protein 6 | 2 | 4 | ||||||||
MIRT519625 | ZNF781 | zinc finger protein 781 | 2 | 2 | ||||||||
MIRT519838 | ZFP69B | ZFP69 zinc finger protein B | 2 | 4 | ||||||||
MIRT528560 | DNAAF3 | dynein axonemal assembly factor 3 | 2 | 2 | ||||||||
MIRT530718 | ORMDL3 | ORMDL sphingolipid biosynthesis regulator 3 | 2 | 2 | ||||||||
MIRT530810 | GPR182 | G protein-coupled receptor 182 | 2 | 2 | ||||||||
MIRT533265 | VAV3 | vav guanine nucleotide exchange factor 3 | 2 | 4 | ||||||||
MIRT533726 | TMEM246 | transmembrane protein 246 | 2 | 2 | ||||||||
MIRT535547 | P2RY2 | purinergic receptor P2Y2 | 2 | 2 | ||||||||
MIRT536019 | MCUR1 | mitochondrial calcium uniporter regulator 1 | 2 | 2 | ||||||||
MIRT539494 | ACTN4 | actinin alpha 4 | 2 | 2 | ||||||||
MIRT541793 | MGAT5 | mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase | 2 | 8 | ||||||||
MIRT554509 | RUNX1T1 | RUNX1 translocation partner 1 | 2 | 2 | ||||||||
MIRT558784 | CEP55 | centrosomal protein 55 | 2 | 2 | ||||||||
MIRT560013 | ZNF525 | zinc finger protein 525 | 2 | 2 | ||||||||
MIRT560078 | ZNF195 | zinc finger protein 195 | 2 | 2 | ||||||||
MIRT570135 | IL1RL2 | interleukin 1 receptor like 2 | 2 | 2 | ||||||||
MIRT570890 | ZNF780A | zinc finger protein 780A | 2 | 2 | ||||||||
MIRT607972 | SNX22 | sorting nexin 22 | 2 | 2 | ||||||||
MIRT608104 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | 2 | 2 | ||||||||
MIRT610471 | ADAMTS13 | ADAM metallopeptidase with thrombospondin type 1 motif 13 | 2 | 4 | ||||||||
MIRT611134 | GGT7 | gamma-glutamyltransferase 7 | 2 | 2 | ||||||||
MIRT611448 | NRIP3 | nuclear receptor interacting protein 3 | 2 | 2 | ||||||||
MIRT613019 | GABPB1 | GA binding protein transcription factor beta subunit 1 | 2 | 4 | ||||||||
MIRT615753 | C6 | complement C6 | 2 | 2 | ||||||||
MIRT620464 | CERS6 | ceramide synthase 6 | 2 | 2 | ||||||||
MIRT632248 | VPS41 | VPS41, HOPS complex subunit | 2 | 2 | ||||||||
MIRT636099 | ZDHHC22 | zinc finger DHHC-type containing 22 | 2 | 2 | ||||||||
MIRT637452 | ZNF324B | zinc finger protein 324B | 2 | 2 | ||||||||
MIRT638927 | CALCOCO2 | calcium binding and coiled-coil domain 2 | 2 | 2 | ||||||||
MIRT646768 | WDR3 | WD repeat domain 3 | 2 | 2 | ||||||||
MIRT652610 | TIMM8A | translocase of inner mitochondrial membrane 8A | 2 | 2 | ||||||||
MIRT652868 | TAB1 | TGF-beta activated kinase 1 (MAP3K7) binding protein 1 | 2 | 2 | ||||||||
MIRT653655 | SLC27A4 | solute carrier family 27 member 4 | 2 | 2 | ||||||||
MIRT657089 | JMY | junction mediating and regulatory protein, p53 cofactor | 2 | 2 | ||||||||
MIRT657884 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | 2 | 2 | ||||||||
MIRT662919 | MED18 | mediator complex subunit 18 | 2 | 2 | ||||||||
MIRT685622 | C12orf49 | chromosome 12 open reading frame 49 | 2 | 2 | ||||||||
MIRT687427 | NRIP1 | nuclear receptor interacting protein 1 | 2 | 2 | ||||||||
MIRT692304 | CNNM3 | cyclin and CBS domain divalent metal cation transport mediator 3 | 2 | 2 | ||||||||
MIRT695127 | PRY2 | PTPN13-like, Y-linked 2 | 2 | 2 | ||||||||
MIRT695144 | PRY | PTPN13-like, Y-linked | 2 | 2 | ||||||||
MIRT696286 | IER3IP1 | immediate early response 3 interacting protein 1 | 2 | 2 | ||||||||
MIRT699350 | SLC35E1 | solute carrier family 35 member E1 | 2 | 2 | ||||||||
MIRT709901 | AGO1 | argonaute 1, RISC catalytic component | 2 | 2 | ||||||||
MIRT710877 | SLC25A42 | solute carrier family 25 member 42 | 2 | 2 | ||||||||
MIRT711365 | MED7 | mediator complex subunit 7 | 2 | 2 | ||||||||
MIRT711444 | FRMPD3 | FERM and PDZ domain containing 3 | 2 | 2 | ||||||||
MIRT713221 | RCAN2 | regulator of calcineurin 2 | 2 | 2 | ||||||||
MIRT713281 | LAIR1 | leukocyte associated immunoglobulin like receptor 1 | 2 | 2 | ||||||||
MIRT714195 | TRAF7 | TNF receptor associated factor 7 | 2 | 2 | ||||||||
MIRT715152 | IL12B | interleukin 12B | 2 | 2 | ||||||||
MIRT719197 | CASP10 | caspase 10 | 2 | 2 | ||||||||
MIRT719469 | SRF | serum response factor | 2 | 2 | ||||||||
MIRT720197 | MPP6 | membrane palmitoylated protein 6 | 2 | 2 | ||||||||
MIRT720449 | SLC16A5 | solute carrier family 16 member 5 | 2 | 2 | ||||||||
MIRT720461 | RAB31 | RAB31, member RAS oncogene family | 2 | 2 | ||||||||
MIRT721646 | ZNF207 | zinc finger protein 207 | 2 | 2 | ||||||||
MIRT722001 | CLLU1OS | chronic lymphocytic leukemia up-regulated 1 opposite strand | 2 | 2 | ||||||||
MIRT725521 | FAM229B | family with sequence similarity 229 member B | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|