miRTarBase - #MIRT559077


—
pre-miRNA Information
pre-miRNA hsa-mir-4753   
Genomic Coordinates chr1: 235190034 - 235190116
Description Homo sapiens miR-4753 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4753-5p
Sequence 10| CAAGGCCAAAGGAAGAGAACAG |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs547986869 3 dbSNP
rs1007787337 7 dbSNP
rs1224263160 12 dbSNP
rs1256249071 13 dbSNP
rs1484015538 14 dbSNP
rs535678819 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C19orf47
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 126526.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacaagagaagGAAACCGgaac 5'
                     | |||||    
Target 5' -----------CCUUGGCagaa 3'
 		1 - 11
2 
miRNA  3' gacAAGAGAAGGAAACCGGaac 5'
             ||:||| ||  |  ||   
Target 5' cacUUUUCUACC--UCUCCcaa 3'
 		14 - 33
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_178830 | 3UTR | UUCUCUGGCUGUGGCCUUGGCAGAACCCACUUUUCUACCUCUCCCAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000582783.1 | 3UTR | CCUUGGCAGAACCCACUUUUCUACCUCUCCCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
94 hsa-miR-4753-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064916 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT161166 SLC25A36 solute carrier family 25 member 36 2 2
MIRT285542 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT308266 LRIG1 leucine rich repeats and immunoglobulin like domains 1 2 2
MIRT311425 LMNB1 lamin B1 2 2
MIRT373989 PEBP1 phosphatidylethanolamine binding protein 1 2 4
MIRT383141 CRY2 cryptochrome circadian clock 2 2 2
MIRT405243 ADIPOR2 adiponectin receptor 2 2 2
MIRT441620 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 6
MIRT441789 SRPK1 SRSF protein kinase 1 2 2
MIRT441804 NOC3L NOC3 like DNA replication regulator 2 2
MIRT441832 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT442005 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT442411 LIMD1 LIM domains containing 1 2 2
MIRT442708 UBE4B ubiquitination factor E4B 2 2
MIRT442714 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT442738 SERINC5 serine incorporator 5 2 2
MIRT442793 CEP170 centrosomal protein 170 2 2
MIRT442984 ZNF736 zinc finger protein 736 2 2
MIRT443055 THRB thyroid hormone receptor beta 2 2
MIRT443288 ZC3H12A zinc finger CCCH-type containing 12A 2 2
MIRT443325 SLC35G1 solute carrier family 35 member G1 2 2
MIRT443331 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT443593 ZNF439 zinc finger protein 439 2 4
MIRT443696 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT443748 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT443866 HDLBP high density lipoprotein binding protein 2 2
MIRT461185 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT464074 WAC WW domain containing adaptor with coiled-coil 2 2
MIRT468738 SDC4 syndecan 4 2 2
MIRT470540 COASY Coenzyme A synthase 2 2
MIRT476458 GBA2 glucosylceramidase beta 2 2 2
MIRT479470 CDK6 cyclin dependent kinase 6 2 2
MIRT486351 TACC2 transforming acidic coiled-coil containing protein 2 2 8
MIRT495126 CXorf67 chromosome X open reading frame 67 2 2
MIRT495166 CNGA2 cyclic nucleotide gated channel alpha 2 2 4
MIRT495432 ATG7 autophagy related 7 2 2
MIRT495922 FBXO41 F-box protein 41 2 2
MIRT496572 DGCR6L DiGeorge syndrome critical region gene 6 like 2 2
MIRT498277 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT498431 DDX39A DExD-box helicase 39A 2 2
MIRT530149 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT530313 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT530880 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT531177 ZNF626 zinc finger protein 626 2 2
MIRT533395 TYRP1 tyrosinase related protein 1 2 2
MIRT533709 TMEM64 transmembrane protein 64 2 2
MIRT533954 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 2
MIRT535616 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT539472 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT542878 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT559077 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT559465 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT561233 ZNF772 zinc finger protein 772 2 2
MIRT563477 POLE3 DNA polymerase epsilon 3, accessory subunit 2 2
MIRT563995 SLFN11 schlafen family member 11 2 2
MIRT564222 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT566017 RHOA ras homolog family member A 2 2
MIRT566028 RFX1 regulatory factor X1 2 2
MIRT566591 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT567874 CTDSP1 CTD small phosphatase 1 2 2
MIRT568552 AKT2 AKT serine/threonine kinase 2 2 2
MIRT569357 EFHC1 EF-hand domain containing 1 2 2
MIRT569973 DNAAF2 dynein axonemal assembly factor 2 2 2
MIRT614423 ZNF440 zinc finger protein 440 2 2
MIRT628831 SLC25A34 solute carrier family 25 member 34 2 2
MIRT630142 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT634479 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT634498 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT637394 R3HDM2 R3H domain containing 2 2 2
MIRT641840 TCF7L2 transcription factor 7 like 2 2 2
MIRT644397 CDKL1 cyclin dependent kinase like 1 2 2
MIRT644888 C2orf50 chromosome 2 open reading frame 50 2 2
MIRT647124 ZNF446 zinc finger protein 446 2 2
MIRT647420 SSTR3 somatostatin receptor 3 2 2
MIRT650297 PYCARD PYD and CARD domain containing 2 2
MIRT655488 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT658185 FBXO9 F-box protein 9 2 2
MIRT660931 ADAM19 ADAM metallopeptidase domain 19 2 2
MIRT665317 ZBTB3 zinc finger and BTB domain containing 3 2 2
MIRT670350 C1orf106 chromosome 1 open reading frame 106 2 4
MIRT670823 NICN1 nicolin 1 2 2
MIRT671825 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT672732 NETO2 neuropilin and tolloid like 2 2 2
MIRT674841 GLRX2 glutaredoxin 2 2 2
MIRT675930 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT686786 AZF1 azoospermia factor 1 2 2
MIRT697723 USP8 ubiquitin specific peptidase 8 2 2
MIRT702357 KLHL26 kelch like family member 26 2 2
MIRT704361 DBR1 debranching RNA lariats 1 2 2
MIRT709242 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT714433 SNED1 sushi, nidogen and EGF like domains 1 2 2
MIRT717000 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT720875 ADCY5 adenylate cyclase 5 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4753 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4753-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4753-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4753-5p Platinum 23939 resistant tissue
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission