pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4752 |
Genomic Coordinates | chr19: 54282109 - 54282180 |
Description | Homo sapiens miR-4752 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4752 | |||||||||||||||
Sequence | 10| UUGUGGAUCUCAAGGAUGUGCU |31 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | |||||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ZNF83 | ||||||||||||||||||||
Synonyms | HPF1, ZNF816B | ||||||||||||||||||||
Description | zinc finger protein 83 | ||||||||||||||||||||
Transcript | NM_001105549 | ||||||||||||||||||||
Other Transcripts | NM_001105550 , NM_001105551 , NM_001105552 , NM_018300 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on ZNF83 | |||||||||||||||||||||
3'UTR of ZNF83 (miRNA target sites are highlighted) |
>ZNF83|NM_001105549|3'UTR 1 TGTGGCAGAGTGTTCAGTTAGCATTAAAGCCTTGTAAGACATACAATAATTTATACTGGAGAAAAACTTTGCAAGTATAA 81 TGAATGTAGCAGAGCCTTTAGTTTTTGTTCAAGGCTTAATAACCGTTAGCTAGACCATAGAGGACAGAAACTTTACTAAT 161 GTACTGAATGTGGCAAGGTCTTAAGGTAAAATCTGAGACCAGGATTCTTCAAAGAATTCTTGCTGGTGAGAAACCTAACA 241 AATGTAATGAATGTGGCAAGGTCTTCTGGCACAATTCTCACATTGTACAATATTGCAAAAATTCATGCTTGAGAGAAACA 321 AAAACACTGAGAGTGGGAAACCATTATGACTTCAAACATTCATCAACATCAGAGAATCCATACTAAAGAGCATTTATAAT 401 AATTATATGTGATAGAGATTTTCCGCAGGCCAAAGTCTCACTAGGCATCAAAAACTTTTTTGATGAAACCATACAAATGT 481 AACGTGCATGCTTAAGCTTTTACCCAGGCATCAAAACCGGAACATCACAGGGTTTATACTGGAGAGTAACTACACAAAGA 561 TAATGTAATAAGCCTTTCAGTGTAATATTCATGATTTTGTCGTGAGAGATCCACTCAATAAAAACCAGGCAAATGTAGTG 641 AATCTGGAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
CLIP-seq Support 1 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000594682.2 | 3UTR | aauccacacuggagagaaacc |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
57 hsa-miR-4752 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT291951 | TPM4 | tropomyosin 4 | 2 | 2 | ||||||||
MIRT293610 | PVR | poliovirus receptor | 2 | 2 | ||||||||
MIRT454768 | STOML3 | stomatin like 3 | 2 | 2 | ||||||||
MIRT463215 | ZNF131 | zinc finger protein 131 | 2 | 2 | ||||||||
MIRT464138 | VPS28 | VPS28, ESCRT-I subunit | 2 | 2 | ||||||||
MIRT469361 | REST | RE1 silencing transcription factor | 2 | 6 | ||||||||
MIRT470819 | PLXND1 | plexin D1 | 2 | 2 | ||||||||
MIRT478874 | CREBRF | CREB3 regulatory factor | 2 | 2 | ||||||||
MIRT480240 | C8orf58 | chromosome 8 open reading frame 58 | 2 | 2 | ||||||||
MIRT480544 | BZW1 | basic leucine zipper and W2 domains 1 | 2 | 2 | ||||||||
MIRT480923 | BCAT1 | branched chain amino acid transaminase 1 | 2 | 4 | ||||||||
MIRT497342 | RPP25L | ribonuclease P/MRP subunit p25 like | 2 | 2 | ||||||||
MIRT498823 | DNTTIP2 | deoxynucleotidyltransferase terminal interacting protein 2 | 2 | 8 | ||||||||
MIRT498927 | TMEM106B | transmembrane protein 106B | 2 | 8 | ||||||||
MIRT499583 | INTU | inturned planar cell polarity protein | 2 | 4 | ||||||||
MIRT500117 | ZNF106 | zinc finger protein 106 | 2 | 4 | ||||||||
MIRT500473 | ZC3H11A | zinc finger CCCH-type containing 11A | 2 | 2 | ||||||||
MIRT501907 | MBD4 | methyl-CpG binding domain 4, DNA glycosylase | 2 | 4 | ||||||||
MIRT519636 | ZNF772 | zinc finger protein 772 | 2 | 4 | ||||||||
MIRT533402 | TXLNG | taxilin gamma | 2 | 2 | ||||||||
MIRT546181 | TPRG1L | tumor protein p63 regulated 1 like | 2 | 2 | ||||||||
MIRT546486 | SKI | SKI proto-oncogene | 2 | 4 | ||||||||
MIRT549398 | AKAP11 | A-kinase anchoring protein 11 | 2 | 2 | ||||||||
MIRT552282 | CBY1 | chibby family member 1, beta catenin antagonist | 2 | 4 | ||||||||
MIRT558980 | CA8 | carbonic anhydrase 8 | 2 | 2 | ||||||||
MIRT559812 | ZNF83 | zinc finger protein 83 | 2 | 2 | ||||||||
MIRT559923 | SOD2 | superoxide dismutase 2 | 2 | 2 | ||||||||
MIRT560257 | TMEM236 | transmembrane protein 236 | 2 | 2 | ||||||||
MIRT560419 | ANGPTL3 | angiopoietin like 3 | 2 | 2 | ||||||||
MIRT560548 | SIGLEC14 | sialic acid binding Ig like lectin 14 | 2 | 2 | ||||||||
MIRT560803 | PPIP5K2 | diphosphoinositol pentakisphosphate kinase 2 | 2 | 2 | ||||||||
MIRT560882 | SULT1B1 | sulfotransferase family 1B member 1 | 2 | 2 | ||||||||
MIRT560996 | C8orf37 | chromosome 8 open reading frame 37 | 2 | 2 | ||||||||
MIRT561089 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | 2 | 2 | ||||||||
MIRT561192 | LDHD | lactate dehydrogenase D | 2 | 2 | ||||||||
MIRT561834 | NREP | neuronal regeneration related protein | 2 | 2 | ||||||||
MIRT561997 | LPP | LIM domain containing preferred translocation partner in lipoma | 2 | 2 | ||||||||
MIRT562394 | EIF4E | eukaryotic translation initiation factor 4E | 2 | 2 | ||||||||
MIRT566265 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | 2 | 2 | ||||||||
MIRT572724 | NUP188 | nucleoporin 188 | 2 | 2 | ||||||||
MIRT620359 | CD55 | CD55 molecule (Cromer blood group) | 2 | 2 | ||||||||
MIRT623578 | IREB2 | iron responsive element binding protein 2 | 2 | 2 | ||||||||
MIRT627122 | GRN | granulin precursor | 2 | 2 | ||||||||
MIRT640725 | PHF13 | PHD finger protein 13 | 2 | 2 | ||||||||
MIRT651578 | WDR26 | WD repeat domain 26 | 2 | 2 | ||||||||
MIRT655000 | PLAG1 | PLAG1 zinc finger | 2 | 2 | ||||||||
MIRT659673 | CD86 | CD86 molecule | 2 | 2 | ||||||||
MIRT667164 | NRXN1 | neurexin 1 | 2 | 2 | ||||||||
MIRT674926 | C1orf116 | chromosome 1 open reading frame 116 | 2 | 2 | ||||||||
MIRT687377 | NT5DC3 | 5'-nucleotidase domain containing 3 | 2 | 2 | ||||||||
MIRT690438 | REPIN1 | replication initiator 1 | 2 | 2 | ||||||||
MIRT695288 | TK1 | thymidine kinase 1 | 2 | 2 | ||||||||
MIRT699809 | SDHD | succinate dehydrogenase complex subunit D | 2 | 2 | ||||||||
MIRT710100 | HEY2 | hes related family bHLH transcription factor with YRPW motif 2 | 2 | 2 | ||||||||
MIRT717882 | GBP4 | guanylate binding protein 4 | 2 | 2 | ||||||||
MIRT719957 | SAMD15 | sterile alpha motif domain containing 15 | 2 | 2 | ||||||||
MIRT725588 | CDH7 | cadherin 7 | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|