miRTarBase - #MIRT559827


—
pre-miRNA Information
pre-miRNA hsa-mir-2115   
Genomic Coordinates chr3: 48316360 - 48316459
Description Homo sapiens miR-2115 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2115-3p
Sequence 58| CAUCAGAAUUCAUGGAGGCUAG |79
Evidence Experimental
Experiments 454
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31490809 22 COSMIC
COSN31579735 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs543123304 18 dbSNP
rs1450988157 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SLPI   
Synonyms ALK1, ALP, BLPI, HUSI, HUSI-I, MPI, WAP4, WFDC4
Description secretory leukocyte peptidase inhibitor
Transcript NM_003064   
Expression
Putative miRNA Targets on SLPI
3'UTR of SLPI
(miRNA target sites are highlighted)		 
>SLPI|NM_003064|3'UTR
   1 TTCCTGCCATATGGAGGAGGCTCTGGAGTCCTGCTCTGTGTGGTCCAGGTCCTTTCCACCCTGAGACTTGGCTCCACCAC
  81 TGATATCCTCCTTTGGGGAAAGGCTTGGCACACAGCAGGCTTTCAAGAAGTGCCAGTTGATCAATGAATAAATAAACGAG
 161 CCTATTTCTCTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaUCGGAGGUACUUAAGACUAc 5'
            || |||:: ||:| ||| | 
Target 5' ggAGGCTCTG-GAGTCCTGCTc 3'
 16 - 36 103.00 -10.22
2 
miRNA  3' gauCGGAGGUACUUAAGACUAc 5'
             | |||||  |   ||||| 
Target 5' cttGGCTCCACCA---CTGATa 3'
 67 - 85 102.00 -9.90
3 
miRNA  3' gaUCGGAGGUACUUAAGAcuac 5'
            |||||  ||   ||||    
Target 5' cgAGCCT--AT---TTCTcttt 3'
 157 - 173 93.00 -5.26
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30486502 3 COSMIC
COSN30163931 11 COSMIC
COSN26958267 12 COSMIC
COSN30459213 14 COSMIC
COSN30510870 14 COSMIC
COSN30191687 17 COSMIC
COSN31577930 20 COSMIC
COSN31500973 26 COSMIC
COSN30154548 36 COSMIC
COSN30453880 42 COSMIC
COSN30456174 45 COSMIC
COSN30461483 51 COSMIC
COSN30487268 56 COSMIC
COSN30171348 83 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs374682055 3 dbSNP
rs1336826705 4 dbSNP
rs370530861 11 dbSNP
rs771927717 12 dbSNP
rs1295324806 20 dbSNP
rs2664550 23 dbSNP
rs1228808916 28 dbSNP
rs745327399 30 dbSNP
rs187024490 37 dbSNP
rs756901663 39 dbSNP
rs1221154033 40 dbSNP
rs753551616 46 dbSNP
rs781500645 47 dbSNP
rs1207299476 50 dbSNP
rs374921640 56 dbSNP
rs1057432 58 dbSNP
rs1473439822 59 dbSNP
rs1184073255 65 dbSNP
rs1061188 76 dbSNP
rs3171242 79 dbSNP
rs1410596916 86 dbSNP
rs756929309 87 dbSNP
rs748533820 96 dbSNP
rs1017772985 103 dbSNP
rs1458486065 104 dbSNP
rs1318366821 107 dbSNP
rs1387614184 108 dbSNP
rs1190956883 109 dbSNP
rs3178901 112 dbSNP
rs1009533349 118 dbSNP
rs1489026812 128 dbSNP
rs1377102414 129 dbSNP
rs1008893411 130 dbSNP
rs781447982 133 dbSNP
rs1289062299 142 dbSNP
rs1032376213 145 dbSNP
rs532097051 149 dbSNP
rs755500389 157 dbSNP
rs8282 158 dbSNP
rs1037545099 160 dbSNP
rs948493676 161 dbSNP
rs894434423 165 dbSNP
rs1186689192 173 dbSNP
rs113562215 176 dbSNP
rs74769243 177 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaUCGGAGGUACUUAAGacuac 5'
            | :| |: ||  |||     
Target 5' auACUCCCUUUGUCUUCccucu 3'
 		1 - 22
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000566377.1 | 3UTR | AUACUCCCUUUGUCUUCCCUCUCUACUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.182 0.16 0.183 0.16 31 Click to see details
BLCA 0.461 0.18 0.257 0.31 6 Click to see details
LIHC -0.483 0.26 0.000 0.5 4 Click to see details
STAD 0.464 0.35 0.500 0.33 3 Click to see details
HNSC -0.09 0.38 0.143 0.31 14 Click to see details
LUSC 0.066 0.41 0.046 0.44 15 Click to see details
UCEC 0.139 0.46 0.500 0.33 3 Click to see details
UCEC 0.139 0.46 0.500 0.33 3 Click to see details
UCEC 0.139 0.46 0.500 0.33 3 Click to see details
UCEC 0.139 0.46 0.500 0.33 3 Click to see details
UCEC 0.139 0.46 0.500 0.33 3 Click to see details
UCEC 0.139 0.46 0.500 0.33 3 Click to see details
UCEC 0.139 0.46 0.500 0.33 3 Click to see details
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057089 DDIT4 DNA damage inducible transcript 4 2 2
MIRT071216 FCF1 FCF1, rRNA-processing protein 2 2
MIRT226901 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235961 BACH1 BTB domain and CNC homolog 1 2 2
MIRT294569 ZNF460 zinc finger protein 460 2 4
MIRT321046 RAC1 Rac family small GTPase 1 2 4
MIRT359666 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 8
MIRT366451 KLHL15 kelch like family member 15 2 2
MIRT405375 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT441794 TCEAL5 transcription elongation factor A like 5 2 2
MIRT443295 TCEAL3 transcription elongation factor A like 3 2 2
MIRT455275 DDX39B DExD-box helicase 39B 2 2
MIRT458523 C5orf22 chromosome 5 open reading frame 22 2 2
MIRT464960 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT466848 STX6 syntaxin 6 2 2
MIRT469252 RHOB ras homolog family member B 2 2
MIRT469825 RAB14 RAB14, member RAS oncogene family 2 4
MIRT470047 PTGFRN prostaglandin F2 receptor inhibitor 2 2
MIRT471420 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT472024 NPM1 nucleophosmin 1 2 2
MIRT484156 CENPN centromere protein N 2 2
MIRT485490 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT490462 PROSER2 proline and serine rich 2 2 2
MIRT493069 MTCH1 mitochondrial carrier 1 2 2
MIRT493573 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT494919 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT500439 ZMAT3 zinc finger matrin-type 3 2 2
MIRT500931 SRPR SRP receptor alpha subunit 2 4
MIRT501551 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT501809 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT502415 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT506504 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT507861 CCNE2 cyclin E2 2 2
MIRT510511 YOD1 YOD1 deubiquitinase 2 6
MIRT516073 RAB42 RAB42, member RAS oncogene family 2 2
MIRT519030 KYNU kynureninase 2 6
MIRT521762 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522898 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527370 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530691 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT530867 TRUB1 TruB pseudouridine synthase family member 1 2 2
MIRT531832 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT533035 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT533165 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT533464 TRIM71 tripartite motif containing 71 2 2
MIRT534331 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT539372 ADSS adenylosuccinate synthase 2 6
MIRT545951 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553283 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553532 TMEM185B transmembrane protein 185B 2 4
MIRT556480 LIPA lipase A, lysosomal acid type 2 2
MIRT556975 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT557697 GATA6 GATA binding protein 6 2 2
MIRT558901 CCDC58 coiled-coil domain containing 58 2 2
MIRT559224 BLMH bleomycin hydrolase 2 2
MIRT559827 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT563435 SLC3A2 solute carrier family 3 member 2 2 2
MIRT569270 PCDH11X protocadherin 11 X-linked 2 2
MIRT571386 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572567 AFF1 AF4/FMR2 family member 1 2 2
MIRT610400 AR androgen receptor 2 2
MIRT611058 ZNF621 zinc finger protein 621 2 2
MIRT635118 TMEM233 transmembrane protein 233 2 2
MIRT641617 DEFB118 defensin beta 118 2 2
MIRT642146 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT647295 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT648155 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT652780 TENM3 teneurin transmembrane protein 3 2 2
MIRT657356 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT658718 ELN elastin 2 2
MIRT662441 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT665302 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT699898 RUNX1 runt related transcription factor 1 2 2
MIRT700921 PDS5A PDS5 cohesin associated factor A 2 2
MIRT700992 PDE3A phosphodiesterase 3A 2 2
MIRT707397 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT711895 INSIG2 insulin induced gene 2 2 2
MIRT712072 XRCC5 X-ray repair cross complementing 5 2 2
MIRT716121 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT724470 SMAD2 SMAD family member 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2115 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-2115 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-2115-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-2115-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-2115-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission