pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-103b-1 |
Genomic Coordinates | chr5: 168560904 - 168560965 |
Description | Homo sapiens miR-103b-1 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases | |
pre-miRNA | hsa-mir-103b-2 |
Genomic Coordinates | chr20: 3917502 - 3917563 |
Description | Homo sapiens miR-103b-2 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-103b | |||||||||||||||||||||
Sequence | 1| UCAUAGCCCUGUACAAUGCUGCU |23 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | ChIP-seq | DRVs in miRNA |
|
|||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ZNF567 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | zinc finger protein 567 | ||||||||||||||||||||
Transcript | NM_152603 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on ZNF567 | |||||||||||||||||||||
3'UTR of ZNF567 (miRNA target sites are highlighted) |
>ZNF567|NM_152603|3'UTR 1 ATGATGTGGTTTCTTATATGAATTCTTTACAAGCTGTTGTAAACATTTAGTTTTAAAAAGAAAAGCATGCTGAAACATGT 81 TAATGTAATTTTAAATCACAAGTCTAATAATTATTAAAGTACCATACGGAATAACTGTCTACTGTTTACTAGCATATAAA 161 ATAAGTATGATCATTATTATTGAACTCTATCAGCTATGAAGCTAAATTTTAAAGTCAACTGCTCTTCCTACTGACTCAAA 241 TAGTTTATTTTTTAAAAATACTTATATAATACATGCAGAGACAAGATACACAATGATTATAAGTATTAATCTCCATAAGA 321 GAAAATATTTATGAACTATATTTCTCATTGCACTCTGTAATAAAAAGCAGTTAGTTGTTACTTACCTAAGAGTTACCACT 401 TCCGTAGCCTATAACATCAAAACGTAGTTTTTGCATGTTTTCAATTTTATAAATATATATTTTATCAGACATCATGAATT 481 ATTTTGTGTCTTGCTTATTTCACTCAATTTTTTAAGATCTGTACATTATTGCATGTGGCAGTAGTGTATTTTCATTTTGC 561 ATACTATTCCATTTTAAGAATATATTGCTGTTTATCCTATTGATGGATATTTGTATTTTTTATACTTTTGTGTAATAATA 641 AAAATACTGCTGTAAATATTCTTGTTTAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
CLIP-seq Support 1 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000536254.2 | 3UTR | AACUCUAUCAGCUAUGAAGCUAAAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
53 hsa-miR-103b Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT218386 | E2F3 | E2F transcription factor 3 | 2 | 2 | ||||||||
MIRT404221 | RPL7L1 | ribosomal protein L7 like 1 | 2 | 2 | ||||||||
MIRT441502 | SPG20 | spartin | 2 | 6 | ||||||||
MIRT444124 | ZNRF3 | zinc and ring finger 3 | 2 | 2 | ||||||||
MIRT454236 | OSBPL10 | oxysterol binding protein like 10 | 2 | 4 | ||||||||
MIRT457919 | ZNF212 | zinc finger protein 212 | 2 | 2 | ||||||||
MIRT462254 | LAMA4 | laminin subunit alpha 4 | 2 | 2 | ||||||||
MIRT463176 | ZNF281 | zinc finger protein 281 | 2 | 2 | ||||||||
MIRT472355 | TSPAN1 | tetraspanin 1 | 2 | 2 | ||||||||
MIRT474133 | LIN54 | lin-54 DREAM MuvB core complex component | 2 | 4 | ||||||||
MIRT494946 | IFFO2 | intermediate filament family orphan 2 | 2 | 2 | ||||||||
MIRT497403 | NPY4R | neuropeptide Y receptor Y4 | 2 | 2 | ||||||||
MIRT497641 | GLDN | gliomedin | 2 | 2 | ||||||||
MIRT505340 | TMEM245 | transmembrane protein 245 | 2 | 6 | ||||||||
MIRT505680 | SESTD1 | SEC14 and spectrin domain containing 1 | 2 | 6 | ||||||||
MIRT510706 | SREK1IP1 | SREK1 interacting protein 1 | 2 | 6 | ||||||||
MIRT512198 | C1orf43 | chromosome 1 open reading frame 43 | 2 | 2 | ||||||||
MIRT522089 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | 2 | 4 | ||||||||
MIRT525074 | FRK | fyn related Src family tyrosine kinase | 2 | 2 | ||||||||
MIRT531276 | PPIL3 | peptidylprolyl isomerase like 3 | 2 | 2 | ||||||||
MIRT535119 | PLXNA2 | plexin A2 | 2 | 2 | ||||||||
MIRT540836 | GNAT1 | G protein subunit alpha transducin 1 | 2 | 4 | ||||||||
MIRT541018 | WIPI2 | WD repeat domain, phosphoinositide interacting 2 | 2 | 2 | ||||||||
MIRT545752 | CA12 | carbonic anhydrase 12 | 2 | 4 | ||||||||
MIRT546404 | SRP9 | signal recognition particle 9 | 2 | 2 | ||||||||
MIRT547991 | HCFC2 | host cell factor C2 | 2 | 4 | ||||||||
MIRT554502 | SAE1 | SUMO1 activating enzyme subunit 1 | 2 | 2 | ||||||||
MIRT558360 | DMTF1 | cyclin D binding myb like transcription factor 1 | 2 | 2 | ||||||||
MIRT558863 | CD2AP | CD2 associated protein | 2 | 2 | ||||||||
MIRT559939 | ZNF567 | zinc finger protein 567 | 2 | 2 | ||||||||
MIRT566300 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | 2 | 2 | ||||||||
MIRT567490 | FOXK1 | forkhead box K1 | 2 | 2 | ||||||||
MIRT617139 | ZNF556 | zinc finger protein 556 | 2 | 2 | ||||||||
MIRT625400 | AKR7L | aldo-keto reductase family 7 like (gene/pseudogene) | 2 | 2 | ||||||||
MIRT626491 | CEP89 | centrosomal protein 89 | 2 | 2 | ||||||||
MIRT629487 | GSN | gelsolin | 2 | 4 | ||||||||
MIRT638456 | PLXDC2 | plexin domain containing 2 | 2 | 2 | ||||||||
MIRT648498 | CMBL | carboxymethylenebutenolidase homolog | 2 | 2 | ||||||||
MIRT654845 | PPM1L | protein phosphatase, Mg2+/Mn2+ dependent 1L | 2 | 2 | ||||||||
MIRT664587 | HSD17B12 | hydroxysteroid 17-beta dehydrogenase 12 | 2 | 2 | ||||||||
MIRT664977 | TDRD1 | tudor domain containing 1 | 2 | 2 | ||||||||
MIRT665028 | ELK1 | ELK1, ETS transcription factor | 2 | 2 | ||||||||
MIRT666043 | STON2 | stonin 2 | 2 | 2 | ||||||||
MIRT668863 | CRY2 | cryptochrome circadian clock 2 | 2 | 2 | ||||||||
MIRT669297 | C17orf85 | nuclear cap binding subunit 3 | 2 | 2 | ||||||||
MIRT680975 | DCAF17 | DDB1 and CUL4 associated factor 17 | 2 | 2 | ||||||||
MIRT682267 | RS1 | retinoschisin 1 | 2 | 2 | ||||||||
MIRT685283 | KIAA1143 | KIAA1143 | 2 | 2 | ||||||||
MIRT693375 | PIGP | phosphatidylinositol glycan anchor biosynthesis class P | 2 | 2 | ||||||||
MIRT701785 | MSL1 | male specific lethal 1 homolog | 2 | 2 | ||||||||
MIRT709373 | SPECC1 | sperm antigen with calponin homology and coiled-coil domains 1 | 2 | 2 | ||||||||
MIRT715154 | IL12B | interleukin 12B | 2 | 2 | ||||||||
MIRT734499 | ADAMTS5 | ADAM metallopeptidase with thrombospondin type 1 motif 5 | 3 | 0 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|