miRTarBase - #MIRT559956


—
pre-miRNA Information
pre-miRNA hsa-mir-4523   
Genomic Coordinates chr17: 29390662 - 29390730
Description Homo sapiens miR-4523 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4523
Sequence 7| GACCGAGAGGGCCUCGGCUGU |27
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1403520324 1 dbSNP
rs1015528391 2 dbSNP
rs1391552421 4 dbSNP
rs1168635550 5 dbSNP
rs1448548058 15 dbSNP
Putative Targets

Gene Information
Gene Symbol TRMT112   
Synonyms HSPC152, HSPC170, TRM112, TRMT11-2, hTrm112
Description tRNA methyltransferase subunit 11-2
Transcript NM_016404   
Expression
Putative miRNA Targets on TRMT112
3'UTR of TRMT112
(miRNA target sites are highlighted)		 
>TRMT112|NM_016404|3'UTR
   1 TTGTGCCAGGCGCCAGTTTTTCTTGTTATGACTGTGTATTTTTGTTGATCTATACCCTGTTTCCGAATTCTGCCGTGTGT
  81 ATCCCCAACCCTTGACCCAATGACACCAAACACAGTGTTTTTGAGCTCGGTATTATATATTTTTTTCTCATTAAAGGTTT
 161 AAAACCAAAAGCGGTTTCTCTTTGCAGCAAATATACATTAAAATAGAGTCTCTGTACAGCCAAGGGCTCTGGGCCCTGGC
 241 TTGCCCCATGTCCCTGCGCCTCCCTGGCCAAACCCAAAAATAAATATAGTGTTATTGCTCTGCAGGGCATAGAGGCAGTG
 321 CTCTCCTACCCCCTGAGGAGGCTCGTTGGGAGCTGATGGGGAAGCCCTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugucggcuccgggaGAGCCAg 5'
                        |||||| 
Target 5' acagtgtttttgagCTCGGTa 3'
 112 - 132 120.00 -13.70
2 
miRNA  3' ugUCGGCUCCGGGAGAGCCag 5'
            |||| |||  |||| ||  
Target 5' acAGCCAAGG-GCTCTGGGcc 3'
 216 - 235 114.00 -21.50
3 
miRNA  3' ugUCGGC--UCCGGGAGAGCCAg 5'
            || ||  || :::|||:| | 
Target 5' ccAGGCGCCAGTTTTTCTTGTTa 3'
 6 - 28 109.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN27000084 33 COSMIC
COSN31496670 47 COSMIC
COSN30502668 50 COSMIC
COSN2558076 51 COSMIC
COSN24396943 58 COSMIC
COSN30525184 128 COSMIC
COSN17076185 137 COSMIC
COSN31547245 178 COSMIC
COSN31960640 257 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1427270898 1 dbSNP
rs760170082 4 dbSNP
rs1375711364 6 dbSNP
rs776836709 11 dbSNP
rs751032853 15 dbSNP
rs539398953 16 dbSNP
rs893308432 21 dbSNP
rs760814525 22 dbSNP
rs1225071747 25 dbSNP
rs1244786681 25 dbSNP
rs1452397838 28 dbSNP
rs192294864 29 dbSNP
rs763739836 29 dbSNP
rs1203141967 30 dbSNP
rs1274146355 30 dbSNP
rs1486146826 32 dbSNP
rs747859882 35 dbSNP
rs758006261 38 dbSNP
rs774175841 38 dbSNP
rs922765396 38 dbSNP
rs1304754743 44 dbSNP
rs1193835289 47 dbSNP
rs1390374798 48 dbSNP
rs768562383 49 dbSNP
rs779967388 50 dbSNP
rs1193735211 52 dbSNP
rs752937694 53 dbSNP
rs1186145035 55 dbSNP
rs45463294 59 dbSNP
rs577934678 59 dbSNP
rs1395286609 64 dbSNP
rs1436263700 65 dbSNP
rs936440576 70 dbSNP
rs765448031 79 dbSNP
rs375161349 90 dbSNP
rs1314448637 95 dbSNP
rs1226241037 96 dbSNP
rs910207972 100 dbSNP
rs1348859239 101 dbSNP
rs1236684010 103 dbSNP
rs1218942361 106 dbSNP
rs1482776041 109 dbSNP
rs952669793 114 dbSNP
rs1362941317 115 dbSNP
rs1491547983 115 dbSNP
rs1491317731 116 dbSNP
rs760509012 121 dbSNP
rs1187374559 122 dbSNP
rs1253159020 130 dbSNP
rs1455196292 132 dbSNP
rs145155074 135 dbSNP
rs1364600564 136 dbSNP
rs1159552492 139 dbSNP
rs1391447686 140 dbSNP
rs149984080 141 dbSNP
rs1023266425 144 dbSNP
rs1012838753 147 dbSNP
rs1371741948 147 dbSNP
rs567342412 147 dbSNP
rs1239474197 148 dbSNP
rs1467580819 151 dbSNP
rs1327001716 157 dbSNP
rs1357289462 171 dbSNP
rs1253533713 172 dbSNP
rs959897966 178 dbSNP
rs1410274107 180 dbSNP
rs1266267807 182 dbSNP
rs1419248910 188 dbSNP
rs1182998472 208 dbSNP
rs1035509985 210 dbSNP
rs1455966422 214 dbSNP
rs572460127 219 dbSNP
rs679730 220 dbSNP
rs1448477431 222 dbSNP
rs1459540952 223 dbSNP
rs998629803 229 dbSNP
rs11541032 234 dbSNP
rs565583510 235 dbSNP
rs1392113548 240 dbSNP
rs373707219 245 dbSNP
rs1042743595 247 dbSNP
rs1236176902 253 dbSNP
rs1227530253 257 dbSNP
rs187444371 263 dbSNP
rs1308408132 265 dbSNP
rs369242666 268 dbSNP
rs1277175724 274 dbSNP
rs1264286551 290 dbSNP
rs866252902 300 dbSNP
rs1011618680 303 dbSNP
rs888783404 304 dbSNP
rs183554515 308 dbSNP
rs1315824478 312 dbSNP
rs3204919 312 dbSNP
rs544054283 314 dbSNP
rs1376912875 316 dbSNP
rs530174517 317 dbSNP
rs1162778561 319 dbSNP
rs561379177 320 dbSNP
rs879483780 323 dbSNP
rs1372228591 329 dbSNP
rs761700423 330 dbSNP
rs1428784565 331 dbSNP
rs1041170409 332 dbSNP
rs1226467391 333 dbSNP
rs1311910649 337 dbSNP
rs1307626489 343 dbSNP
rs1272082787 345 dbSNP
rs1482497750 350 dbSNP
rs1204911096 355 dbSNP
rs1166314308 358 dbSNP
rs1421495847 369 dbSNP
rs1180683934 377 dbSNP
rs1412303183 381 dbSNP
rs1413676307 383 dbSNP
rs1429237586 385 dbSNP
rs1181830488 387 dbSNP
rs1170520564 389 dbSNP
rs41294424 390 dbSNP
rs908585227 396 dbSNP
rs984142546 400 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugucggcuccgggaGAGCCAg 5'
                        |||||| 
Target 5' ------uuuuugagCUCGGUa 3'
 		1 - 15
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000535126.1 | 3UTR | UUUUUGAGCUCGGUAUUAUAUAUUUUUUUCUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000535126.1 | 3UTR | UUUUUGAGCUCGGUAUUAUAUAUUUUUUUCUCAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
16 hsa-miR-4523 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT396185 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT441527 SESTD1 SEC14 and spectrin domain containing 1 2 2
MIRT480991 BBC3 BCL2 binding component 3 2 2
MIRT498385 GPRC5B G protein-coupled receptor class C group 5 member B 2 2
MIRT509230 KIF14 kinesin family member 14 2 6
MIRT512957 MKI67 marker of proliferation Ki-67 2 2
MIRT528920 TOMM20 translocase of outer mitochondrial membrane 20 2 6
MIRT550979 TOR4A torsin family 4 member A 2 2
MIRT555585 PISD phosphatidylserine decarboxylase 2 2
MIRT556609 LDOC1L retrotransposon Gag like 6 2 4
MIRT559956 TRMT112 tRNA methyltransferase subunit 11-2 2 2
MIRT568202 CBX6 chromobox 6 2 2
MIRT568992 RBM12B RNA binding motif protein 12B 2 2
MIRT569974 TMEM184A transmembrane protein 184A 2 2
MIRT623835 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT704083 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4523 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4523 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4523 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-4523 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4523 Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-4523 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4523 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission