pre-miRNA Information
pre-miRNA hsa-mir-513c   
Genomic Coordinates chrX: 147189704 - 147189787
Synonyms MIRN513C, hsa-mir-513c, MIR513C
Description Homo sapiens miR-513c stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-513c-5p
Sequence 14| UUCUCAAGGAGGUGUCGUUUAU |35
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 X - 147189768 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1198915942 4 dbSNP
rs781939345 15 dbSNP
rs782303096 16 dbSNP
rs782290927 17 dbSNP
rs782660543 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DCAF17   
Synonyms C20orf37, C2orf37
Description DDB1 and CUL4 associated factor 17
Transcript NM_001164821   
Other Transcripts NM_025000   
Expression
Putative miRNA Targets on DCAF17
3'UTR of DCAF17
(miRNA target sites are highlighted)
>DCAF17|NM_001164821|3'UTR
   1 AAAGAGTGAGATAATTGTAACCTAAGAGACTTTTAGCCAAACACCCCAGCAGCTGCGTCCAATCCATTTTATTATCTGCA
  81 TGGCACATTCTCCAGTATTTTCCAAAAAAGTCTTGTGTTGACTTCAGATGACTATGACTTCTTTTTTAAACTCTTGCTGT
 161 AAAAGATGGTGAGGACTTCATTTTTTTTAAAGGTTTTTTAGAATACTGTTCCAAGAAGTTTAGTGTTTTGCAGCTTTGAG
 241 CTAGGTGGTAATGCAAATATAAAATGCTGGGAACAGAAAAGGACAGGTTAATTCCAATTGTTGAGGAGTTAAGTCATTGA
 321 TGGGGTGGGTCATTGATGAGTTCTTAAAGGATGGTATGGAATTTTGTTTGTTAAGGCTAGGAAAGACAGGGAGAGACAAA
 401 AGTAAACATGCAGAAAGAAATCTTATATCCTCTATACCAAACTTTGCTTAAGGATGAGAAATGAGATGTGTTATGTGAGA
 481 ACATTATTTTGAGCCCAAAATGTGTCATCACAGTTTTTAAAAATCTTATATATGTATTTATATGTGTTTCGTATTTGTAT
 561 ATAGTATCAGGAATTGGTTCTAGTTCCCAAATTATCTTTTCTTCCTTGGTTTTGTTCTCTTGGCTTGATGTTCACATTGA
 641 ATATTTGTGTTTCTATATAGGCTAATGTAAAAGATTCCAAGCAAACCTTAAGTGAAATTGTTTTCTGATTTGCATCCTGT
 721 TTAGCTCTTAATGTATCTAAGGATGTTCTCATCTCACCATTCTACTCATTTAGTGAGTTTTCTGATCTTGTTTAGGCAAT
 801 ATTTGCATACTTATGCAATAAGATAAAGGTACCCTTGCCTGCAGTAGTTCTGTTTCCTGTAGAAAAGTGGATAAAGAGTC
 881 CCAGAAGAAGTTCTTACTAGCTTGGGAGTTACCTGATTAACCAGAGAAAATTTTTGGCTTACTTATGGAACAAGCATTAT
 961 TTCTTCTTTGTTAGGAAAGATCTAAATATGGTCCTTGACTTTTAATAATCATTCTTTAGAATGTTAAATAAAGGCAACCC
1041 AAGTAAAGGGAGAAAATGTTTCTTTGTGCTTCCTGTTTGAGAAATTCAGTTGCTTCCATTTCGCATGTTCTGCACATTTA
1121 TCCGATGTAACCTCAAAAGAATAACTGGTAATAAGGGAAGGAAACAGCAGCAACAATCATTGCTGATTCAAGTTTAAGGT
1201 TAAAATATGGAATTTTTAGCTTGGATGATTTATATTAAAATCTTTCCATTTTTTTTTTCAGTTTTGGCTTGATGCCATGT
1281 TAAGAATGATGTGAATTCTTCCCAGTTCTGCCCTGGTGCTAGACATTGCCCCATACTTTCAATTAGACACTAGCTGTATC
1361 TAAATAGTCCCACTCAGTAAACTTACATCTTGAAAAACAAGACCAGTAAGAGGCCAGTGAAAGTACTAAAGAAAGAAACC
1441 AATGTTGTGTGAGTTTCAAAGCAGCTGCAATGCTGTGTAAAAGTAGAGTGTTCATTCTCCATTTCCAAGAGTGTTTCAGA
1521 ATAGGATGTCTTAAGACTTCAGTCATGTCAGAGATTTTTTTTTTTAGGTGATTATTGAGTTTCTCCTTCTCCTTTAAGTC
1601 ATCACCTTCCTTTTATGAAATGATAGTAAGGAACTCGTCTATTCTGAAAGGCATTTGAGAAATAGCTGAATTCCTGGCTG
1681 CTTTTTTGCTGGGGGTAGATGGTGGAATACTTCTGGTCTAGATATAACTTACCACTAAGAAACCCCCAGTATGTCACCAC
1761 TGCCTAAATCTAACTAGACCAGGGTCCAAATGCCATCCAGGCCAGGCAGGAAATATACCTCATGTGAAAGACAGTAAGGA
1841 GTTGTGGGCAGTGTAACAAACAGGAGAGCTATGCCCCAACTAAAAGGAGCAGCTGCTACTGCTTAGTTTCAGCCAGTTGC
1921 AACAGTATGTGGGAATGTAGGCTGCATGGTTGTTAACAAGATAGATGGTAAAAAGATGCCAGAAGATACAGAAGATAGCA
2001 AAGAATGTGGGGAATTTGGATACCACACATAGCGAGAGACAATGAAGCATGCTTCCCAGCTCGCCAGAGTGTCACACAGC
2081 TGCTCATTCTGCCACCTGCCAGACATTAATGTCTTCCTGCCCTACCTAAACCCCCTCTTTACCTGATATTTTAATTCGAG
2161 ACTCTAGCTACATGCCCACCTACTTAACAGGTACTAGTGACAGGTACAAAACATTATGGGTAACAATTCTGAGTGTTTAA
2241 TGCAAGCCCAGGTGAAGCAGGGTAGCTTCCATCAGCAGGTACAGACGTTACGCTGAAAAGAGGTGCATTCTGCATTGCAC
2321 TCCTGGATCTAAGTTTCTGCATTCTCAGAGCATCAATGCAGCAAGCTTATTGTTCCTCAATTTTTTACAATATTTATCAC
2401 AACTCTGGGAGAAAACAAAACAAATCCTATCCTATTTACTATTTGTGCTACCTAGTGAGGAGATACCGCTCTGTTTAGAC
2481 AAATTAAGGCACTTCACATTCTTCCACCAATTGAAAGTTTTGTATCTTACAGTTCTTTTTTTAAATAATATATTTATTGA
2561 GCACTTTCTATCTACTAGTCACTGTGATACAGTATAAGTAAAGTGGGTTGTCTCATTTAATATTCAGAATAACCACATGA
2641 AGTATGAACTGCCATTATCTTTCCCCTTTGTACAAATGAGGAAAGTGAGGCTCACAGAAGTTAATTGGCCCAGGGTCCCA
2721 CAACTAGTCAGTGCAGAGGTGGGAAACATAACCAGATTTGTTCGGCATGAACTTGTGCCAAATTTCCTCCAAAGTTCTCA
2801 AAAGGCAAGGCATGTTATTTTATCCCAATTTAGCATACCAACAACTATAATACTAGATATGTAGGAAAGTGCTTAATAAT
2881 CGTTTTTTACTGATGATTCAGTGTCTAAATTTTGAACAAATTTGGGTAAGATACAAGTCACACATAAATTGACAGAAAAT
2961 GTAGTTCTTCATTCAATGGTTAGCAGTCATTAAAAGGTACTTTCCCTTTGTTTGTGGTGATAATCAGTATTAGTAGTTTT
3041 CATATTATTTGGCTTCCATATTAATCATTTTTATATTTTCTTCTCCTTCTTACCATGTTTACTTATATCATCCATCTTTT
3121 AGAATCCCAGGGAGCTAATTTCTGGTCCCTGTGTTGCTATCAAATCTGTATCTTGCAGAAAGAATAATTTATTTCAAACA
3201 AGGGACATACAATAGAAAGATAAGACCTACTGAGGTCTTTTTCCCATCATTTTATTATGAAAAATGTTCAAACATACAGT
3281 AAAATTGAAAGAATTTTATAGTAAATACTGACCACGGGGATTCTACATCTTACTCTACTTGTTTTATTATTTTCCTATCC
3361 AGCGTACTTTTTGATGGATTTCAAAATAAATTGCAGTTGCTGATATACTTCCCCCTAGTACTTCAACTGCAGATTATTAA
3441 CTAGAGTTTAGTATTTATTTAGTTTTTAAATTTTTTTGATTTAAGATTTACCTGCAATAAAATGTACAAATCTTAAGTAT
3521 AAATTTACTGAGTTCTTGCAGACATATACACCTGTGTAACCCAAACCCTTTCCAAAATTTAGACCATTGCAATCATCTTC
3601 AGAAAGTTTCCTAAATCCCTCTCCCAGTCTATCCCCTCCCCACCCCTCAGGTATAACTACTGTTCTCATTCTTTTATATC
3681 AAAGGTTAAATTTACCTGTTCTAAACTTCATATGAGTGAAATTATACAAAATGTAATGCTTCTTTCACTTAGCATAATGT
3761 TTTTGAGATTTATTCATGTTGTTGCATGTGTCAGTGATTCATTTCTTTTTATTGCTGAGTATTCTTTCGTATGAATATAT
3841 CACAGTTTGTTTTTTTATCTTTCTGTTGATGGACACTGGGCTCTTTCTGCTTGTTTTTTACTGTTATGAATAAAGCTGCT
3921 ATGAACATTCTTAGACAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uauuUGCUGUGGAGGAACUCUu 5'
              ::| : ||| :|||||| 
Target 5' ctttGTGCTTCCTGTTTGAGAa 3'
1062 - 1083 138.00 -14.40
2
miRNA  3' uauUUGCUGUGGAGGAACUCUu 5'
             |:|   |: |::|||||| 
Target 5' cttAGCATAATGTTTTTGAGAt 3'
3748 - 3769 135.00 -9.30
3
miRNA  3' uaUUUGCUGUGGAGGAACUCUu 5'
            :|| |:||    :|||||| 
Target 5' ctGAAAGGCA----TTTGAGAa 3'
1644 - 1661 134.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
332273 16 ClinVar
332274 49 ClinVar
332275 106 ClinVar
332276 127 ClinVar
894111 154 ClinVar
332277 189 ClinVar
894112 212 ClinVar
332278 351 ClinVar
894506 379 ClinVar
894507 424 ClinVar
894508 433 ClinVar
332279 531 ClinVar
332280 571 ClinVar
332281 677 ClinVar
332282 678 ClinVar
332283 809 ClinVar
893083 865 ClinVar
893084 877 ClinVar
893085 927 ClinVar
332284 1006 ClinVar
893086 1035 ClinVar
893087 1121 ClinVar
893088 1125 ClinVar
332285 1166 ClinVar
332286 1249 ClinVar
893291 1371 ClinVar
332287 1485 ClinVar
893292 1522 ClinVar
332288 1532 ClinVar
893293 1541 ClinVar
332289 1555 ClinVar
893294 1558 ClinVar
893295 1693 ClinVar
332290 1748 ClinVar
332291 1842 ClinVar
894138 1966 ClinVar
332292 2067 ClinVar
894139 2114 ClinVar
332293 2184 ClinVar
332294 2203 ClinVar
894140 2242 ClinVar
332295 2293 ClinVar
894141 2304 ClinVar
332296 2313 ClinVar
894546 2319 ClinVar
332297 2341 ClinVar
332298 2349 ClinVar
332299 2381 ClinVar
332300 2426 ClinVar
332301 2430 ClinVar
332302 2474 ClinVar
893118 2536 ClinVar
893119 2592 ClinVar
332303 2624 ClinVar
332304 2748 ClinVar
332305 2776 ClinVar
332306 2796 ClinVar
893120 2944 ClinVar
893332 2948 ClinVar
332307 2965 ClinVar
332308 2972 ClinVar
332309 2977 ClinVar
332310 3007 ClinVar
893333 3023 ClinVar
893334 3108 ClinVar
332311 3113 ClinVar
893335 3171 ClinVar
332312 3454 ClinVar
894173 3552 ClinVar
332313 3704 ClinVar
332314 3706 ClinVar
332315 3713 ClinVar
894174 3812 ClinVar
332316 3830 ClinVar
332317 3836 ClinVar
332318 3881 ClinVar
COSM1009542 1 COSMIC
COSN24385432 4 COSMIC
COSN30142232 16 COSMIC
COSN31497748 19 COSMIC
COSN26972842 38 COSMIC
COSN32098724 128 COSMIC
COSN30492843 179 COSMIC
COSN31583466 187 COSMIC
COSN28866034 189 COSMIC
COSN31526689 189 COSMIC
COSN31599723 197 COSMIC
COSN9866593 272 COSMIC
COSN16992914 503 COSMIC
COSN24125415 518 COSMIC
COSN27255062 1259 COSMIC
COSN27392619 1566 COSMIC
COSN29752911 1660 COSMIC
COSN29392479 2196 COSMIC
COSN29513604 2896 COSMIC
COSN21740297 3117 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774610171 4 dbSNP
rs1318557536 9 dbSNP
rs974304955 12 dbSNP
rs146258833 16 dbSNP
rs529368169 17 dbSNP
rs111508787 21 dbSNP
rs113618728 21 dbSNP
rs775915730 25 dbSNP
rs1231169813 26 dbSNP
rs547884737 37 dbSNP
rs1329715218 41 dbSNP
rs566193671 42 dbSNP
rs1281612315 46 dbSNP
rs1263602568 48 dbSNP
rs753380867 49 dbSNP
rs917621207 51 dbSNP
rs1193446383 54 dbSNP
rs1210446033 56 dbSNP
rs756963461 57 dbSNP
rs752103736 58 dbSNP
rs749985794 61 dbSNP
rs1045338453 64 dbSNP
rs758318127 67 dbSNP
rs1281554162 70 dbSNP
rs1473891147 71 dbSNP
rs1474873933 72 dbSNP
rs780033111 75 dbSNP
rs183464591 80 dbSNP
rs754675602 81 dbSNP
rs913040289 84 dbSNP
rs781065193 87 dbSNP
rs1302216067 88 dbSNP
rs1357600889 89 dbSNP
rs1412719206 96 dbSNP
rs1438521206 104 dbSNP
rs551802113 106 dbSNP
rs1363814967 108 dbSNP
rs1350884827 109 dbSNP
rs1289167244 110 dbSNP
rs771324052 111 dbSNP
rs1277680217 114 dbSNP
rs1042844114 116 dbSNP
rs1316348077 120 dbSNP
rs770811882 124 dbSNP
rs139116642 127 dbSNP
rs1173233646 128 dbSNP
rs1345220178 130 dbSNP
rs746007838 131 dbSNP
rs1275881241 133 dbSNP
rs537382523 134 dbSNP
rs995843045 135 dbSNP
rs1029754748 137 dbSNP
rs1358270818 138 dbSNP
rs779164442 138 dbSNP
rs559176507 143 dbSNP
rs1051423486 152 dbSNP
rs1478413852 154 dbSNP
rs1485707880 155 dbSNP
rs761267211 160 dbSNP
rs768860063 161 dbSNP
rs1279250134 162 dbSNP
rs1434412774 163 dbSNP
rs1169437952 167 dbSNP
rs188188790 168 dbSNP
rs1431351192 174 dbSNP
rs1326810897 175 dbSNP
rs1296050415 176 dbSNP
rs746203651 181 dbSNP
rs772187578 181 dbSNP
rs1005531454 182 dbSNP
rs1335030601 188 dbSNP
rs142315519 189 dbSNP
rs764928097 190 dbSNP
rs1368143983 191 dbSNP
rs1233163386 192 dbSNP
rs1297844758 193 dbSNP
rs1018880916 194 dbSNP
rs1238447911 194 dbSNP
rs962858859 195 dbSNP
rs1344780109 207 dbSNP
rs963898465 209 dbSNP
rs974336214 212 dbSNP
rs1272926566 214 dbSNP
rs749932237 215 dbSNP
rs1190696630 217 dbSNP
rs1256215448 219 dbSNP
rs1475783815 219 dbSNP
rs1208034445 220 dbSNP
rs1356183279 222 dbSNP
rs1224427393 224 dbSNP
rs1251266139 229 dbSNP
rs1453851391 234 dbSNP
rs1217608968 239 dbSNP
rs1481427322 240 dbSNP
rs1189480662 241 dbSNP
rs1392214620 249 dbSNP
rs1451104549 253 dbSNP
rs1165882347 259 dbSNP
rs759826689 260 dbSNP
rs1395486137 266 dbSNP
rs1286557659 275 dbSNP
rs1295124976 275 dbSNP
rs1354675367 277 dbSNP
rs534906173 277 dbSNP
rs1405948988 279 dbSNP
rs1325408579 284 dbSNP
rs762387316 289 dbSNP
rs867895251 298 dbSNP
rs1298947910 304 dbSNP
rs1320844188 305 dbSNP
rs1461857996 307 dbSNP
rs1366829628 309 dbSNP
rs534394499 310 dbSNP
rs1023678288 317 dbSNP
rs1167481195 320 dbSNP
rs1462444829 323 dbSNP
rs1224776301 325 dbSNP
rs765891154 328 dbSNP
rs1357464390 337 dbSNP
rs1230584447 347 dbSNP
rs969443583 348 dbSNP
rs3795996 351 dbSNP
rs1035420657 357 dbSNP
rs754977913 361 dbSNP
rs947837118 362 dbSNP
rs1192739098 363 dbSNP
rs1274825415 368 dbSNP
rs1372328368 371 dbSNP
rs3795997 379 dbSNP
rs989154752 380 dbSNP
rs545393430 381 dbSNP
rs757543988 384 dbSNP
rs925129781 386 dbSNP
rs747147998 388 dbSNP
rs775631025 388 dbSNP
rs779206254 398 dbSNP
rs1307714505 399 dbSNP
rs1390201588 405 dbSNP
rs1374891764 407 dbSNP
rs746101734 410 dbSNP
rs1394452140 420 dbSNP
rs1161960601 423 dbSNP
rs1317171792 424 dbSNP
rs1341472276 429 dbSNP
rs772229487 433 dbSNP
rs1291985546 434 dbSNP
rs947214436 435 dbSNP
rs1229536253 446 dbSNP
rs192793810 451 dbSNP
rs184741043 455 dbSNP
rs921716331 470 dbSNP
rs780212623 471 dbSNP
rs1257057630 472 dbSNP
rs931710862 475 dbSNP
rs1189718123 479 dbSNP
rs891108882 483 dbSNP
rs1051467808 484 dbSNP
rs543380542 490 dbSNP
rs1474879603 497 dbSNP
rs1159778090 501 dbSNP
rs1007415356 509 dbSNP
rs1365089344 509 dbSNP
rs747441331 512 dbSNP
rs1157666860 515 dbSNP
rs1402390975 523 dbSNP
rs1018343154 526 dbSNP
rs1416532945 529 dbSNP
rs762022365 530 dbSNP
rs115676571 531 dbSNP
rs995635626 533 dbSNP
rs1411014324 539 dbSNP
rs1025911547 541 dbSNP
rs1334080921 543 dbSNP
rs951645717 546 dbSNP
rs1238363949 549 dbSNP
rs776847935 551 dbSNP
rs899380837 552 dbSNP
rs1208980876 554 dbSNP
rs1277974542 562 dbSNP
rs762232315 567 dbSNP
rs3795998 571 dbSNP
rs1252533853 572 dbSNP
rs980946168 583 dbSNP
rs1180391780 592 dbSNP
rs1377686581 593 dbSNP
rs1310616597 597 dbSNP
rs1436275198 597 dbSNP
rs1171325543 601 dbSNP
rs1207799285 607 dbSNP
rs1375270689 615 dbSNP
rs1430743549 621 dbSNP
rs1257512251 631 dbSNP
rs1300452905 634 dbSNP
rs1394880831 635 dbSNP
rs772797259 636 dbSNP
rs1023751854 637 dbSNP
rs1332877924 641 dbSNP
rs1216042974 642 dbSNP
rs573804203 656 dbSNP
rs1302893918 660 dbSNP
rs1211873630 663 dbSNP
rs1346922357 667 dbSNP
rs936514333 670 dbSNP
rs1253025313 673 dbSNP
rs987968835 675 dbSNP
rs3821084 677 dbSNP
rs115798465 678 dbSNP
rs1051673575 690 dbSNP
rs1178652657 691 dbSNP
rs533510209 697 dbSNP
rs1433743010 711 dbSNP
rs956936813 726 dbSNP
rs1394123776 733 dbSNP
rs1169472674 736 dbSNP
rs758911517 740 dbSNP
rs1450485513 743 dbSNP
rs189949476 749 dbSNP
rs766924280 751 dbSNP
rs1431054819 753 dbSNP
rs1178740783 758 dbSNP
rs1461981248 764 dbSNP
rs1294610788 767 dbSNP
rs1396814148 773 dbSNP
rs1438754690 783 dbSNP
rs1325481939 791 dbSNP
rs1461983630 794 dbSNP
rs1366135524 798 dbSNP
rs556403631 802 dbSNP
rs1276742621 808 dbSNP
rs886055108 809 dbSNP
rs891135177 812 dbSNP
rs1230873490 813 dbSNP
rs1297544579 815 dbSNP
rs942694418 817 dbSNP
rs1305520893 818 dbSNP
rs1039814085 819 dbSNP
rs1226661704 821 dbSNP
rs1403015650 830 dbSNP
rs1265904832 832 dbSNP
rs1293411865 848 dbSNP
rs898548799 849 dbSNP
rs995585073 851 dbSNP
rs1211200574 852 dbSNP
rs1025859018 855 dbSNP
rs1410387282 858 dbSNP
rs1395508931 862 dbSNP
rs887266932 864 dbSNP
rs1252006347 870 dbSNP
rs1465113802 871 dbSNP
rs1187898615 873 dbSNP
rs1462966455 873 dbSNP
rs1365811011 875 dbSNP
rs370150751 877 dbSNP
rs551788116 878 dbSNP
rs1166150809 883 dbSNP
rs1236012808 889 dbSNP
rs1420569089 892 dbSNP
rs1184256691 897 dbSNP
rs1459958049 909 dbSNP
rs576350801 911 dbSNP
rs1217715289 914 dbSNP
rs751026272 922 dbSNP
rs62183509 927 dbSNP
rs569982209 937 dbSNP
rs1245593297 947 dbSNP
rs1433207089 951 dbSNP
rs759375695 952 dbSNP
rs1227295888 964 dbSNP
rs531211176 974 dbSNP
rs978624073 987 dbSNP
rs1353635319 989 dbSNP
rs1381398463 992 dbSNP
rs1293831167 995 dbSNP
rs73976168 1006 dbSNP
rs969461411 1009 dbSNP
rs567960772 1010 dbSNP
rs1272062141 1012 dbSNP
rs1425356221 1013 dbSNP
rs1329201016 1018 dbSNP
rs931742127 1022 dbSNP
rs1239965737 1027 dbSNP
rs755912021 1030 dbSNP
rs1182747474 1032 dbSNP
rs1428308971 1032 dbSNP
rs3731979 1035 dbSNP
rs766988676 1038 dbSNP
rs1403472423 1041 dbSNP
rs867145560 1043 dbSNP
rs754514206 1044 dbSNP
rs1160327691 1049 dbSNP
rs750634308 1050 dbSNP
rs1402469807 1059 dbSNP
rs1470654733 1062 dbSNP
rs1426451280 1064 dbSNP
rs1157232342 1065 dbSNP
rs911617115 1070 dbSNP
rs553199100 1073 dbSNP
rs1221479596 1074 dbSNP
rs1452801011 1075 dbSNP
rs565430048 1076 dbSNP
rs1285773186 1085 dbSNP
rs1313320610 1087 dbSNP
rs987831297 1095 dbSNP
rs1357127097 1098 dbSNP
rs1412899521 1103 dbSNP
rs758732684 1104 dbSNP
rs933140491 1105 dbSNP
rs1373468582 1106 dbSNP
rs987812743 1113 dbSNP
rs1224902421 1116 dbSNP
rs1281715681 1121 dbSNP
rs1346856586 1123 dbSNP
rs1036025777 1124 dbSNP
rs779974974 1125 dbSNP
rs1379985205 1126 dbSNP
rs1282966811 1127 dbSNP
rs747173001 1135 dbSNP
rs181668017 1137 dbSNP
rs1187889829 1144 dbSNP
rs769039613 1152 dbSNP
rs1471200489 1153 dbSNP
rs781676498 1156 dbSNP
rs1455692209 1165 dbSNP
rs886055109 1166 dbSNP
rs1407331737 1174 dbSNP
rs1190925569 1177 dbSNP
rs1438953771 1178 dbSNP
rs1434049229 1187 dbSNP
rs1175725824 1188 dbSNP
rs905386250 1194 dbSNP
rs1377093190 1196 dbSNP
rs942704494 1208 dbSNP
rs1312205640 1209 dbSNP
rs1003683367 1213 dbSNP
rs1444280145 1218 dbSNP
rs748671292 1219 dbSNP
rs1399189545 1224 dbSNP
rs1371948898 1227 dbSNP
rs1234636690 1237 dbSNP
rs545278792 1246 dbSNP
rs1212598950 1248 dbSNP
rs1039762080 1249 dbSNP
rs745661005 1249 dbSNP
rs768693296 1249 dbSNP
rs886055110 1249 dbSNP
rs770099902 1252 dbSNP
rs1210526485 1259 dbSNP
rs1274334910 1260 dbSNP
rs1440110658 1261 dbSNP
rs1203029050 1266 dbSNP
rs1232413574 1267 dbSNP
rs1488835170 1268 dbSNP
rs1246951628 1271 dbSNP
rs1035519903 1278 dbSNP
rs1487736820 1278 dbSNP
rs1393433391 1279 dbSNP
rs780757035 1282 dbSNP
rs1270687861 1284 dbSNP
rs1400757521 1288 dbSNP
rs1172847231 1289 dbSNP
rs1419963846 1291 dbSNP
rs1411634744 1299 dbSNP
rs1010024943 1301 dbSNP
rs931411660 1303 dbSNP
rs1022290050 1310 dbSNP
rs1436836611 1322 dbSNP
rs773600080 1326 dbSNP
rs748910614 1328 dbSNP
rs1440949713 1341 dbSNP
rs968652902 1343 dbSNP
rs770671472 1347 dbSNP
rs1413099007 1351 dbSNP
rs1412171399 1355 dbSNP
rs1187619410 1361 dbSNP
rs1407164841 1367 dbSNP
rs1477747989 1370 dbSNP
rs565065854 1371 dbSNP
rs1271206130 1380 dbSNP
rs887289707 1384 dbSNP
rs1213376510 1386 dbSNP
rs1272860414 1387 dbSNP
rs1468970949 1388 dbSNP
rs1215575779 1391 dbSNP
rs755782376 1395 dbSNP
rs1344861403 1399 dbSNP
rs1468259203 1403 dbSNP
rs1273362045 1404 dbSNP
rs1217946264 1405 dbSNP
rs766946153 1406 dbSNP
rs1418063721 1407 dbSNP
rs775518305 1407 dbSNP
rs1242543149 1409 dbSNP
rs1276417535 1411 dbSNP
rs533336462 1414 dbSNP
rs1476244005 1420 dbSNP
rs1166122043 1424 dbSNP
rs1296168642 1425 dbSNP
rs1342137318 1428 dbSNP
rs1418618736 1429 dbSNP
rs1400314252 1430 dbSNP
rs1283542881 1431 dbSNP
rs879637626 1433 dbSNP
rs1166538745 1443 dbSNP
rs1391643480 1445 dbSNP
rs777591762 1446 dbSNP
rs760726025 1448 dbSNP
rs1047092141 1450 dbSNP
rs1356654672 1468 dbSNP
rs1428983288 1472 dbSNP
rs1270145133 1474 dbSNP
rs905475908 1476 dbSNP
rs540288434 1478 dbSNP
rs1271396051 1480 dbSNP
rs1334230634 1483 dbSNP
rs1422073985 1484 dbSNP
rs1205970647 1485 dbSNP
rs886055111 1485 dbSNP
rs1475243603 1487 dbSNP
rs953206369 1489 dbSNP
rs1255132039 1493 dbSNP
rs753734153 1496 dbSNP
rs1448520427 1497 dbSNP
rs987288010 1499 dbSNP
rs758537916 1501 dbSNP
rs911634671 1502 dbSNP
rs1233263523 1504 dbSNP
rs1189939006 1509 dbSNP
rs1415087058 1510 dbSNP
rs77176791 1522 dbSNP
rs1316030621 1525 dbSNP
rs1158817901 1526 dbSNP
rs537066061 1532 dbSNP
rs1398582890 1541 dbSNP
rs1322400776 1542 dbSNP
rs1312024461 1543 dbSNP
rs1318158844 1550 dbSNP
rs560178345 1555 dbSNP
rs766299946 1555 dbSNP
rs886055112 1555 dbSNP
rs920241912 1558 dbSNP
rs1417221206 1559 dbSNP
rs1291929043 1566 dbSNP
rs1354938820 1567 dbSNP
rs774025973 1568 dbSNP
rs930286669 1568 dbSNP
rs755028977 1569 dbSNP
rs926841736 1571 dbSNP
rs1418162565 1572 dbSNP
rs1204765269 1573 dbSNP
rs964699419 1573 dbSNP
rs1458810465 1575 dbSNP
rs781276466 1576 dbSNP
rs1485863204 1578 dbSNP
rs1212964444 1580 dbSNP
rs779024389 1586 dbSNP
rs1255269000 1590 dbSNP
rs756656686 1592 dbSNP
rs1181979395 1599 dbSNP
rs1365026961 1607 dbSNP
rs1056635823 1608 dbSNP
rs1468318083 1609 dbSNP
rs1157657295 1611 dbSNP
rs892580918 1616 dbSNP
rs778092477 1621 dbSNP
rs1311600191 1623 dbSNP
rs931276067 1625 dbSNP
rs1456266959 1627 dbSNP
rs1375309643 1629 dbSNP
rs1254886264 1637 dbSNP
rs1214259258 1638 dbSNP
rs1264970745 1640 dbSNP
rs1392464581 1642 dbSNP
rs1309323589 1643 dbSNP
rs1334021610 1645 dbSNP
rs1009643086 1646 dbSNP
rs749716370 1647 dbSNP
rs1433230973 1652 dbSNP
rs1242661059 1653 dbSNP
rs1348361891 1660 dbSNP
rs1047178470 1669 dbSNP
rs1310250297 1669 dbSNP
rs1236135274 1681 dbSNP
rs1239967439 1682 dbSNP
rs1277909417 1682 dbSNP
rs908589403 1683 dbSNP
rs1043774878 1689 dbSNP
rs1196274067 1692 dbSNP
rs903874983 1693 dbSNP
rs1435521084 1696 dbSNP
rs771202185 1703 dbSNP
rs1395244983 1705 dbSNP
rs1455869123 1707 dbSNP
rs1172223081 1708 dbSNP
rs1046599017 1714 dbSNP
rs773991916 1723 dbSNP
rs745526404 1724 dbSNP
rs1028923025 1729 dbSNP
rs1396685550 1733 dbSNP
rs771570661 1740 dbSNP
rs1326833852 1742 dbSNP
rs1002439413 1748 dbSNP
rs747014569 1748 dbSNP
rs1373395760 1752 dbSNP
rs1438978570 1759 dbSNP
rs1009180303 1768 dbSNP
rs1301034076 1780 dbSNP
rs1486889122 1781 dbSNP
rs1311369996 1782 dbSNP
rs1200269392 1787 dbSNP
rs1018767039 1788 dbSNP
rs768866544 1796 dbSNP
rs971856893 1804 dbSNP
rs1351716108 1807 dbSNP
rs1053933915 1808 dbSNP
rs893491724 1817 dbSNP
rs760665138 1819 dbSNP
rs1336891025 1827 dbSNP
rs1197398485 1833 dbSNP
rs114519296 1842 dbSNP
rs951719936 1845 dbSNP
rs1340601507 1849 dbSNP
rs776564383 1852 dbSNP
rs1191323805 1853 dbSNP
rs573985993 1854 dbSNP
rs1429432811 1857 dbSNP
rs1437919579 1861 dbSNP
rs939614007 1862 dbSNP
rs541223174 1864 dbSNP
rs1371778764 1865 dbSNP
rs769952651 1872 dbSNP
rs764957607 1873 dbSNP
rs1396749297 1878 dbSNP
rs1439046490 1879 dbSNP
rs549116176 1880 dbSNP
rs1293110673 1883 dbSNP
rs1366686633 1888 dbSNP
rs1171837647 1890 dbSNP
rs1192986938 1893 dbSNP
rs1382512134 1894 dbSNP
rs1297658496 1895 dbSNP
rs1324679932 1897 dbSNP
rs1487451905 1904 dbSNP
rs1280966759 1907 dbSNP
rs1201442734 1921 dbSNP
rs1017462563 1922 dbSNP
rs964530080 1925 dbSNP
rs1416173126 1927 dbSNP
rs773607342 1929 dbSNP
rs1277063688 1942 dbSNP
rs973332929 1946 dbSNP
rs1211460075 1948 dbSNP
rs1264452010 1949 dbSNP
rs1486399111 1950 dbSNP
rs1334400240 1953 dbSNP
rs920469294 1959 dbSNP
rs1395026132 1961 dbSNP
rs115869663 1962 dbSNP
rs1260068574 1963 dbSNP
rs1477803922 1964 dbSNP
rs569108215 1966 dbSNP
rs1043847841 1968 dbSNP
rs1420145196 1970 dbSNP
rs1459907225 1974 dbSNP
rs1164353509 1975 dbSNP
rs1466102408 1977 dbSNP
rs1377231937 1980 dbSNP
rs755189449 1981 dbSNP
rs1455531597 1982 dbSNP
rs767557924 1988 dbSNP
rs1358352436 1991 dbSNP
rs908533540 1997 dbSNP
rs1399377612 1998 dbSNP
rs1293775275 2004 dbSNP
rs766836121 2008 dbSNP
rs545198408 2010 dbSNP
rs1188515370 2011 dbSNP
rs949519645 2015 dbSNP
rs1226050897 2020 dbSNP
rs1200877010 2031 dbSNP
rs1311587681 2034 dbSNP
rs996853009 2035 dbSNP
rs1317202987 2036 dbSNP
rs1217456849 2044 dbSNP
rs1259388593 2048 dbSNP
rs1216326103 2050 dbSNP
rs1220119469 2054 dbSNP
rs1488140904 2055 dbSNP
rs1212267031 2059 dbSNP
rs1260150165 2061 dbSNP
rs982590988 2062 dbSNP
rs1474276442 2063 dbSNP
rs926824726 2064 dbSNP
rs1408807015 2065 dbSNP
rs759321882 2066 dbSNP
rs886055113 2067 dbSNP
rs752065485 2068 dbSNP
rs755750047 2069 dbSNP
rs1418819132 2070 dbSNP
rs1313411875 2074 dbSNP
rs1416071015 2079 dbSNP
rs889060136 2083 dbSNP
rs145934835 2084 dbSNP
rs756605585 2090 dbSNP
rs894027485 2091 dbSNP
rs1366911133 2096 dbSNP
rs1019254131 2097 dbSNP
rs1042095533 2099 dbSNP
rs139529937 2114 dbSNP
rs1197023996 2115 dbSNP
rs1379516941 2116 dbSNP
rs1008677186 2118 dbSNP
rs1453780784 2126 dbSNP
rs749770451 2131 dbSNP
rs1235410257 2132 dbSNP
rs1353885149 2134 dbSNP
rs757589748 2135 dbSNP
rs1240691867 2139 dbSNP
rs1282901059 2142 dbSNP
rs1441265018 2144 dbSNP
rs951793015 2145 dbSNP
rs1209990215 2148 dbSNP
rs1375885835 2149 dbSNP
rs779174983 2150 dbSNP
rs745500589 2153 dbSNP
rs1350358292 2156 dbSNP
rs549364274 2158 dbSNP
rs561245876 2159 dbSNP
rs961273998 2160 dbSNP
rs950649434 2161 dbSNP
rs1174091497 2162 dbSNP
rs1385937068 2162 dbSNP
rs1396657456 2163 dbSNP
rs1321191063 2172 dbSNP
rs1440486538 2173 dbSNP
rs1412737860 2175 dbSNP
rs983753930 2180 dbSNP
rs1354645788 2181 dbSNP
rs1015623163 2182 dbSNP
rs73976170 2184 dbSNP
rs1328891688 2185 dbSNP
rs1375770298 2189 dbSNP
rs1441180247 2192 dbSNP
rs1449376257 2194 dbSNP
rs546776106 2199 dbSNP
rs886055114 2203 dbSNP
rs1352465594 2205 dbSNP
rs1306142888 2210 dbSNP
rs926670320 2221 dbSNP
rs1343280169 2227 dbSNP
rs1219178539 2229 dbSNP
rs1220716822 2232 dbSNP
rs938189326 2239 dbSNP
rs1274272098 2241 dbSNP
rs1309335857 2242 dbSNP
rs1196759864 2243 dbSNP
rs1237624233 2252 dbSNP
rs571537121 2255 dbSNP
rs1469126000 2259 dbSNP
rs1195699452 2261 dbSNP
rs1254681061 2267 dbSNP
rs989643272 2272 dbSNP
rs915408684 2280 dbSNP
rs1476896014 2285 dbSNP
rs1220986267 2287 dbSNP
rs767339694 2287 dbSNP
rs1171932777 2288 dbSNP
rs1258868577 2292 dbSNP
rs373833929 2293 dbSNP
rs538868578 2296 dbSNP
rs1411580937 2301 dbSNP
rs186143382 2304 dbSNP
rs1398887136 2308 dbSNP
rs569741110 2310 dbSNP
rs768361114 2312 dbSNP
rs777311799 2313 dbSNP
rs1452366383 2321 dbSNP
rs776654201 2328 dbSNP
rs1436120273 2329 dbSNP
rs536596866 2330 dbSNP
rs1260572604 2333 dbSNP
rs888428 2341 dbSNP
rs1364770727 2345 dbSNP
rs1217331632 2346 dbSNP
rs769595023 2348 dbSNP
rs112519318 2349 dbSNP
rs1277578778 2349 dbSNP
rs1257549661 2350 dbSNP
rs1335496831 2357 dbSNP
rs1215824627 2359 dbSNP
rs1476834260 2364 dbSNP
rs994585312 2366 dbSNP
rs1447075428 2368 dbSNP
rs1340198868 2371 dbSNP
rs534948599 2373 dbSNP
rs1449671333 2375 dbSNP
rs1197981160 2377 dbSNP
rs1450388945 2380 dbSNP
rs553179661 2381 dbSNP
rs1478787377 2387 dbSNP
rs1456988131 2391 dbSNP
rs886259747 2396 dbSNP
rs1191395141 2397 dbSNP
rs1426371570 2398 dbSNP
rs1170843341 2408 dbSNP
rs1160907293 2410 dbSNP
rs1422313212 2411 dbSNP
rs1475224009 2412 dbSNP
rs1166648972 2415 dbSNP
rs1388054480 2418 dbSNP
rs1392479418 2422 dbSNP
rs12151641 2426 dbSNP
rs1319468256 2428 dbSNP
rs778932293 2430 dbSNP
rs760686279 2432 dbSNP
rs1278078737 2434 dbSNP
rs1356183594 2435 dbSNP
rs970755112 2439 dbSNP
rs149691298 2448 dbSNP
rs1282489748 2454 dbSNP
rs1355998255 2456 dbSNP
rs368249337 2460 dbSNP
rs1284758236 2461 dbSNP
rs1230264730 2462 dbSNP
rs993328227 2463 dbSNP
rs745784916 2467 dbSNP
rs772200637 2468 dbSNP
rs1214396422 2469 dbSNP
rs1302674781 2470 dbSNP
rs1262298072 2472 dbSNP
rs1027435305 2473 dbSNP
rs57999878 2474 dbSNP
rs1189085300 2476 dbSNP
rs770193682 2480 dbSNP
rs1340344901 2484 dbSNP
rs1332635466 2490 dbSNP
rs1472284011 2493 dbSNP
rs560982558 2494 dbSNP
rs540049401 2496 dbSNP
rs1158764507 2498 dbSNP
rs1410660165 2500 dbSNP
rs1418184342 2508 dbSNP
rs1001893060 2511 dbSNP
rs1298137659 2512 dbSNP
rs1376658926 2513 dbSNP
rs754327552 2523 dbSNP
rs915441365 2525 dbSNP
rs1339928313 2536 dbSNP
rs1242746328 2543 dbSNP
rs145373123 2546 dbSNP
rs1267271728 2550 dbSNP
rs960418697 2551 dbSNP
rs978387949 2558 dbSNP
rs912093644 2567 dbSNP
rs757742700 2571 dbSNP
rs992202409 2575 dbSNP
rs1285024079 2585 dbSNP
rs1485995766 2587 dbSNP
rs1312274169 2589 dbSNP
rs748228250 2592 dbSNP
rs966949652 2593 dbSNP
rs1379589825 2595 dbSNP
rs1441285601 2596 dbSNP
rs1487189078 2613 dbSNP
rs1182086951 2616 dbSNP
rs1310384544 2619 dbSNP
rs1239557594 2621 dbSNP
rs1394925948 2622 dbSNP
rs886055115 2624 dbSNP
rs979630744 2627 dbSNP
rs1437420762 2634 dbSNP
rs1158494397 2635 dbSNP
rs1396040103 2638 dbSNP
rs1468076620 2639 dbSNP
rs925423896 2643 dbSNP
rs533754425 2645 dbSNP
rs758118215 2646 dbSNP
rs779786259 2647 dbSNP
rs1375027397 2650 dbSNP
rs1349016367 2651 dbSNP
rs1446317220 2655 dbSNP
rs985555336 2658 dbSNP
rs1441098072 2659 dbSNP
rs746673241 2661 dbSNP
rs546863765 2667 dbSNP
rs1235355781 2679 dbSNP
rs886290970 2690 dbSNP
rs1005084715 2692 dbSNP
rs1343693121 2694 dbSNP
rs1193049371 2698 dbSNP
rs1444930622 2701 dbSNP
rs1195932606 2708 dbSNP
rs1488850782 2709 dbSNP
rs1259421338 2713 dbSNP
rs1157676916 2716 dbSNP
rs1456198654 2719 dbSNP
rs944053925 2720 dbSNP
rs148758818 2724 dbSNP
rs907149269 2730 dbSNP
rs897774070 2735 dbSNP
rs1254040486 2737 dbSNP
rs1239843055 2739 dbSNP
rs1001457082 2741 dbSNP
rs1289781040 2741 dbSNP
rs929214777 2743 dbSNP
rs1033666463 2747 dbSNP
rs886055116 2748 dbSNP
rs959355235 2754 dbSNP
rs1421174220 2755 dbSNP
rs773555321 2756 dbSNP
rs1394779994 2757 dbSNP
rs1172997684 2764 dbSNP
rs1022315829 2768 dbSNP
rs1001965149 2770 dbSNP
rs16859404 2776 dbSNP
rs1197320466 2783 dbSNP
rs567330302 2785 dbSNP
rs1368077422 2786 dbSNP
rs1307366458 2792 dbSNP
rs17221346 2796 dbSNP
rs966716591 2804 dbSNP
rs1330516152 2806 dbSNP
rs1348993972 2809 dbSNP
rs774736126 2811 dbSNP
rs974977433 2814 dbSNP
rs1259483120 2815 dbSNP
rs1315469944 2820 dbSNP
rs1197654830 2822 dbSNP
rs556334670 2824 dbSNP
rs1401285867 2825 dbSNP
rs1340807150 2829 dbSNP
rs569647129 2829 dbSNP
rs866562135 2832 dbSNP
rs1217726673 2834 dbSNP
rs921610175 2836 dbSNP
rs1489681284 2838 dbSNP
rs1208491137 2839 dbSNP
rs1013292648 2842 dbSNP
rs1429672808 2843 dbSNP
rs1196444539 2845 dbSNP
rs1421605471 2848 dbSNP
rs1465517366 2851 dbSNP
rs1477514009 2859 dbSNP
rs1198654506 2860 dbSNP
rs930271306 2864 dbSNP
rs537189202 2866 dbSNP
rs548684828 2867 dbSNP
rs752396778 2874 dbSNP
rs1001135273 2879 dbSNP
rs189368440 2882 dbSNP
rs1258743419 2883 dbSNP
rs1445448647 2883 dbSNP
rs75894811 2883 dbSNP
rs1201358671 2887 dbSNP
rs940444681 2889 dbSNP
rs1046016532 2890 dbSNP
rs985991119 2892 dbSNP
rs1337775772 2894 dbSNP
rs1217429323 2901 dbSNP
rs1293359687 2902 dbSNP
rs912685245 2904 dbSNP
rs1242125830 2908 dbSNP
rs1276966188 2916 dbSNP
rs1265278462 2919 dbSNP
rs1160354984 2926 dbSNP
rs1001887058 2927 dbSNP
rs1377414356 2931 dbSNP
rs1486370392 2935 dbSNP
rs1334624207 2936 dbSNP
rs965835850 2944 dbSNP
rs1261574297 2945 dbSNP
rs972785459 2948 dbSNP
rs1305117016 2956 dbSNP
rs1333286584 2956 dbSNP
rs1466027100 2957 dbSNP
rs1188829337 2961 dbSNP
rs1416013015 2962 dbSNP
rs886055117 2965 dbSNP
rs918566962 2965 dbSNP
rs762585568 2966 dbSNP
rs1164282613 2967 dbSNP
rs1474574829 2968 dbSNP
rs576169953 2972 dbSNP
rs78561668 2977 dbSNP
rs1444397147 2983 dbSNP
rs1241614222 2986 dbSNP
rs999596128 2996 dbSNP
rs909101153 2997 dbSNP
rs1299972992 3000 dbSNP
rs767979485 3001 dbSNP
rs374810983 3007 dbSNP
rs886055118 3007 dbSNP
rs760915283 3015 dbSNP
rs1302964850 3017 dbSNP
rs764126945 3018 dbSNP
rs1224526004 3019 dbSNP
rs75833923 3023 dbSNP
rs1284417620 3026 dbSNP
rs1311521685 3026 dbSNP
rs1354873223 3028 dbSNP
rs1380329949 3029 dbSNP
rs1230710920 3037 dbSNP
rs1242841180 3038 dbSNP
rs1284316003 3040 dbSNP
rs1353669187 3053 dbSNP
rs975010091 3057 dbSNP
rs1212193760 3063 dbSNP
rs1328332436 3064 dbSNP
rs1239305642 3067 dbSNP
rs557162290 3074 dbSNP
rs1029209617 3076 dbSNP
rs1055364460 3083 dbSNP
rs575635525 3084 dbSNP
rs1482293024 3086 dbSNP
rs544901449 3089 dbSNP
rs543136730 3093 dbSNP
rs984490390 3096 dbSNP
rs1424200705 3098 dbSNP
rs896270167 3107 dbSNP
rs1180866096 3109 dbSNP
rs1441768452 3109 dbSNP
rs1160311972 3110 dbSNP
rs1440901793 3111 dbSNP
rs17221367 3113 dbSNP
rs1042115157 3115 dbSNP
rs572867368 3116 dbSNP
rs981202979 3117 dbSNP
rs540242814 3129 dbSNP
rs902193930 3131 dbSNP
rs1221314661 3136 dbSNP
rs1419076932 3149 dbSNP
rs1176642683 3152 dbSNP
rs565191054 3160 dbSNP
rs1445089159 3164 dbSNP
rs1287951360 3165 dbSNP
rs865846361 3171 dbSNP
rs1240579857 3183 dbSNP
rs1178628646 3192 dbSNP
rs937153720 3208 dbSNP
rs1055644001 3209 dbSNP
rs763672996 3209 dbSNP
rs1307591457 3210 dbSNP
rs765730468 3211 dbSNP
rs893023810 3213 dbSNP
rs1324238617 3219 dbSNP
rs1404608103 3221 dbSNP
rs1220344504 3226 dbSNP
rs1281256690 3231 dbSNP
rs947300274 3247 dbSNP
rs1044137475 3251 dbSNP
rs1310527860 3255 dbSNP
rs1407625220 3258 dbSNP
rs954273124 3259 dbSNP
rs1209574167 3270 dbSNP
rs1007091158 3271 dbSNP
rs1459293380 3274 dbSNP
rs1198035349 3277 dbSNP
rs1020185626 3278 dbSNP
rs532886693 3286 dbSNP
rs1217153824 3289 dbSNP
rs965516202 3290 dbSNP
rs1438809489 3292 dbSNP
rs1365692144 3295 dbSNP
rs902011327 3299 dbSNP
rs1427108192 3302 dbSNP
rs572264674 3307 dbSNP
rs1174792768 3309 dbSNP
rs1400362302 3310 dbSNP
rs1466882541 3311 dbSNP
rs973249185 3316 dbSNP
rs750945995 3317 dbSNP
rs758777886 3328 dbSNP
rs1437555300 3333 dbSNP
rs1276957155 3334 dbSNP
rs952725289 3336 dbSNP
rs1344992847 3339 dbSNP
rs780589850 3339 dbSNP
rs760034253 3341 dbSNP
rs952313198 3346 dbSNP
rs1217924181 3349 dbSNP
rs1320037024 3360 dbSNP
rs544468117 3363 dbSNP
rs909173262 3364 dbSNP
rs750021840 3365 dbSNP
rs181938173 3378 dbSNP
rs1222106309 3380 dbSNP
rs1054996078 3392 dbSNP
rs1477028228 3394 dbSNP
rs1190502168 3400 dbSNP
rs1423756298 3405 dbSNP
rs1204538758 3408 dbSNP
rs1264515713 3416 dbSNP
rs757732239 3416 dbSNP
rs1478476569 3419 dbSNP
rs1487282765 3421 dbSNP
rs1168108614 3425 dbSNP
rs1399162945 3426 dbSNP
rs1405585975 3433 dbSNP
rs780733984 3436 dbSNP
rs779410799 3438 dbSNP
rs539235134 3443 dbSNP
rs1299303583 3453 dbSNP
rs747674263 3454 dbSNP
rs928367307 3463 dbSNP
rs1262428321 3468 dbSNP
rs1221536037 3471 dbSNP
rs1321518865 3471 dbSNP
rs758748448 3471 dbSNP
rs1215416133 3472 dbSNP
rs768059186 3503 dbSNP
rs1277631227 3507 dbSNP
rs1357369940 3508 dbSNP
rs879141809 3509 dbSNP
rs1361495753 3514 dbSNP
rs569269640 3516 dbSNP
rs1268841171 3519 dbSNP
rs949218997 3520 dbSNP
rs185157481 3526 dbSNP
rs1449613800 3529 dbSNP
rs1221656402 3536 dbSNP
rs1263737102 3539 dbSNP
rs142460755 3543 dbSNP
rs914386439 3545 dbSNP
rs530498334 3548 dbSNP
rs1170736253 3550 dbSNP
rs947332859 3552 dbSNP
rs1410621774 3556 dbSNP
rs1416931823 3561 dbSNP
rs1321877561 3563 dbSNP
rs373344754 3566 dbSNP
rs566345467 3566 dbSNP
rs936359696 3568 dbSNP
rs1053440385 3579 dbSNP
rs1405069877 3585 dbSNP
rs147950025 3586 dbSNP
rs1260123277 3590 dbSNP
rs1205285579 3592 dbSNP
rs1363070112 3593 dbSNP
rs1398690417 3596 dbSNP
rs1297711686 3599 dbSNP
rs749242448 3604 dbSNP
rs770670358 3606 dbSNP
rs1019842902 3621 dbSNP
rs1271147360 3623 dbSNP
rs1282574900 3624 dbSNP
rs1384007019 3625 dbSNP
rs1354007395 3630 dbSNP
rs1314742053 3637 dbSNP
rs1245044664 3641 dbSNP
rs901353658 3650 dbSNP
rs774169442 3651 dbSNP
rs1298308861 3654 dbSNP
rs1330707225 3656 dbSNP
rs1214337446 3661 dbSNP
rs1025688503 3662 dbSNP
rs1461040359 3671 dbSNP
rs996260545 3672 dbSNP
rs1166483973 3675 dbSNP
rs1442457469 3679 dbSNP
rs752201590 3683 dbSNP
rs1345910935 3690 dbSNP
rs887932240 3696 dbSNP
rs1443617934 3697 dbSNP
rs747209139 3702 dbSNP
rs9789572 3704 dbSNP
rs577520268 3706 dbSNP
rs1363929783 3711 dbSNP
rs74780004 3713 dbSNP
rs1403005966 3715 dbSNP
rs991156839 3726 dbSNP
rs962019492 3727 dbSNP
rs1332256313 3731 dbSNP
rs1249632292 3732 dbSNP
rs1311359741 3736 dbSNP
rs1319613018 3754 dbSNP
rs1340161774 3755 dbSNP
rs1224243382 3759 dbSNP
rs1447750810 3768 dbSNP
rs571444202 3771 dbSNP
rs190749922 3776 dbSNP
rs1378780447 3777 dbSNP
rs1237913367 3790 dbSNP
rs1360391728 3793 dbSNP
rs747211504 3798 dbSNP
rs1035759256 3802 dbSNP
rs1291566860 3802 dbSNP
rs768818183 3802 dbSNP
rs1260009164 3806 dbSNP
rs1356549150 3815 dbSNP
rs1308345742 3819 dbSNP
rs141563827 3820 dbSNP
rs773543654 3829 dbSNP
rs59827170 3830 dbSNP
rs1460628949 3831 dbSNP
rs936390939 3834 dbSNP
rs886055119 3836 dbSNP
rs1053469636 3838 dbSNP
rs1438145329 3841 dbSNP
rs1161508597 3845 dbSNP
rs1411706030 3849 dbSNP
rs977743895 3849 dbSNP
rs1378774401 3850 dbSNP
rs1446746587 3850 dbSNP
rs1479286059 3855 dbSNP
rs766820600 3866 dbSNP
rs754667938 3881 dbSNP
rs1192963584 3886 dbSNP
rs1466360867 3891 dbSNP
rs181080251 3900 dbSNP
rs1402205538 3902 dbSNP
rs1490590921 3904 dbSNP
rs1444239790 3905 dbSNP
rs1268439381 3908 dbSNP
rs943944999 3909 dbSNP
rs752404121 3911 dbSNP
rs1331677588 3915 dbSNP
rs536073936 3916 dbSNP
rs889475988 3917 dbSNP
rs1272594862 3922 dbSNP
rs554603193 3928 dbSNP
rs1198888222 3934 dbSNP
rs1164458549 3935 dbSNP
rs1238992671 3937 dbSNP
rs1360072538 3937 dbSNP
rs1315619717 3938 dbSNP
rs1418890469 3939 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000375255.3 | 3UTR | AAAUUCAGUUGCUUCCAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.389 3.0e-2 -0.037 4.3e-1 24 Click to see details
GSE21687 Ependynoma primary tumors 0.193 6.3e-2 0.027 4.2e-1 64 Click to see details
GSE19350 CNS germ cell tumors 0.404 9.6e-2 0.322 1.5e-1 12 Click to see details
GSE21032 Prostate cancer -0.14 1.0e-1 -0.093 2.0e-1 83 Click to see details
GSE19536 Breast cancer -0.116 1.3e-1 -0.070 2.4e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.232 1.3e-1 -0.426 1.7e-2 25 Click to see details
GSE28260 Renal cortex and medulla -0.324 1.4e-1 -0.045 4.4e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.197 1.7e-1 -0.192 1.8e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.385 1.7e-1 -0.429 1.4e-1 8 Click to see details
GSE19783 ER+ ER+ breast cancer 0.183 2.2e-1 0.304 9.6e-2 20 Click to see details
GSE19783 ER- ER- breast cancer -0.079 2.4e-1 -0.083 2.3e-1 79 Click to see details
GSE32688 Pancreatic cancer 0.077 3.4e-1 0.198 1.4e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.085 3.5e-1 -0.024 4.6e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.094 3.5e-1 -0.254 1.4e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.043 4.2e-1 -0.162 2.3e-1 23 Click to see details
GSE38226 Liver fibrosis -0.031 4.5e-1 -0.249 1.4e-1 21 Click to see details
GSE17498 Multiple myeloma 0.018 4.6e-1 0.009 4.8e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.831 0.08 -1.000 0.5 4 Click to see details
LUSC -0.428 0.17 -0.250 0.29 7 Click to see details
KIRC -0.272 0.2 -0.364 0.12 12 Click to see details
UCEC 0.371 0.23 -0.086 0.44 6 Click to see details
THCA -0.128 0.38 0.071 0.43 8 Click to see details
KIRP -0.097 0.43 -0.143 0.39 6 Click to see details
STAD 0.021 0.49 -0.500 0.33 3 Click to see details
STAD 0.021 0.49 -0.500 0.33 3 Click to see details
STAD 0.021 0.49 -0.500 0.33 3 Click to see details
STAD 0.021 0.49 -0.500 0.33 3 Click to see details
STAD 0.021 0.49 -0.500 0.33 3 Click to see details
STAD 0.021 0.49 -0.500 0.33 3 Click to see details
101 hsa-miR-513c-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054517 GNG13 G protein subunit gamma 13 3 1
MIRT054520 DR1 down-regulator of transcription 1 3 1
MIRT054523 BTG3 BTG anti-proliferation factor 3 5 3
MIRT106071 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT169580 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT259392 SLC6A8 solute carrier family 6 member 8 2 4
MIRT271674 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT286338 PHF12 PHD finger protein 12 2 2
MIRT334476 RPL27A ribosomal protein L27a 2 4
MIRT336466 SRP9 signal recognition particle 9 2 2
MIRT442119 KCNH5 potassium voltage-gated channel subfamily H member 5 2 2
MIRT462292 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT474680 KLF10 Kruppel like factor 10 2 2
MIRT475558 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT479224 CKS2 CDC28 protein kinase regulatory subunit 2 2 2
MIRT496188 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT506494 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 4
MIRT509596 PEX26 peroxisomal biogenesis factor 26 2 4
MIRT512412 KIAA0391 KIAA0391 2 2
MIRT512440 SFTPB surfactant protein B 2 2
MIRT512582 ZNF223 zinc finger protein 223 2 2
MIRT525991 MAGEL2 MAGE family member L2 2 2
MIRT526428 PARP15 poly(ADP-ribose) polymerase family member 15 2 4
MIRT526773 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 2
MIRT528091 UCHL3 ubiquitin C-terminal hydrolase L3 2 2
MIRT530439 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT532573 GSS glutathione synthetase 2 2
MIRT533991 SUZ12 SUZ12 polycomb repressive complex 2 subunit 2 2
MIRT534783 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT536247 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT536472 KIAA1549L KIAA1549 like 2 2
MIRT538429 COL19A1 collagen type XIX alpha 1 chain 2 2
MIRT539324 AHSA2 activator of HSP90 ATPase homolog 2 2 4
MIRT547013 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT552911 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT553170 UBE2G1 ubiquitin conjugating enzyme E2 G1 2 2
MIRT553463 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT553552 TMEM161B transmembrane protein 161B 2 2
MIRT556254 MAPRE2 microtubule associated protein RP/EB family member 2 2 2
MIRT556875 ITGA2 integrin subunit alpha 2 2 2
MIRT558153 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT560321 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT564023 CEBPB CCAAT/enhancer binding protein beta 2 2
MIRT566387 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT569340 EFHC1 EF-hand domain containing 1 2 2
MIRT572596 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT574179 TMPO thymopoietin 2 2
MIRT610593 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT615804 COQ7 coenzyme Q7, hydroxylase 2 2
MIRT616715 FEM1B fem-1 homolog B 2 2
MIRT617932 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT620334 SPAST spastin 2 2
MIRT620670 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT620712 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT622710 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT623781 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT624112 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT626538 EMCN endomucin 2 2
MIRT630146 ZDHHC9 zinc finger DHHC-type containing 9 2 4
MIRT631639 WDR91 WD repeat domain 91 2 4
MIRT635123 RAD51 RAD51 recombinase 2 2
MIRT637462 DEFB105B defensin beta 105B 2 4
MIRT637494 DEFB105A defensin beta 105A 2 4
MIRT641198 TRIB1 tribbles pseudokinase 1 2 4
MIRT643397 PROM1 prominin 1 2 2
MIRT644890 ZBED1 zinc finger BED-type containing 1 2 2
MIRT647245 PTGDR2 prostaglandin D2 receptor 2 2 2
MIRT647529 CCDC121 coiled-coil domain containing 121 2 2
MIRT648396 WRN Werner syndrome RecQ like helicase 2 2
MIRT650122 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT652356 TMEM92 transmembrane protein 92 2 2
MIRT653818 SIM2 single-minded family bHLH transcription factor 2 2 2
MIRT653944 SEPSECS Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase 2 2
MIRT657291 HOXB5 homeobox B5 2 2
MIRT657827 GJD3 gap junction protein delta 3 2 2
MIRT658707 EMB embigin 2 2
MIRT658740 ELAVL4 ELAV like RNA binding protein 4 2 2
MIRT660176 BNC2 basonuclin 2 2 2
MIRT661324 TBC1D15 TBC1 domain family member 15 2 2
MIRT662206 PLA2G4E phospholipase A2 group IVE 2 2
MIRT662967 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT663877 CCDC65 coiled-coil domain containing 65 2 2
MIRT671780 RGS17 regulator of G protein signaling 17 2 2
MIRT673645 CYCS cytochrome c, somatic 2 2
MIRT675532 RPL37 ribosomal protein L37 2 2
MIRT676350 KLF8 Kruppel like factor 8 2 2
MIRT678428 PDE4C phosphodiesterase 4C 2 2
MIRT678485 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT690847 PVR poliovirus receptor 2 2
MIRT691992 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT698393 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT701265 NUP210 nucleoporin 210 2 2
MIRT703554 FKBP14 FK506 binding protein 14 2 2
MIRT711985 EXTL3 exostosin like glycosyltransferase 3 2 2
MIRT712654 PGAP3 post-GPI attachment to proteins 3 2 2
MIRT716760 TRABD2A TraB domain containing 2A 2 2
MIRT717932 ZFP64 ZFP64 zinc finger protein 2 2
MIRT718028 FAM163A family with sequence similarity 163 member A 2 2
MIRT718973 SPTSSA serine palmitoyltransferase small subunit A 2 2
MIRT721651 RPL34 ribosomal protein L34 2 2
MIRT724861 RIMBP2 RIMS binding protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-513c-5p (2-chlorophenyl) 2-[[2-(trifluoromethyl)pyridin-4-yl]amino]pyridine-3-carboxylate 11639785 NSC733467 sensitive
hsa-miR-513c-5p (2e)-n-(3-chloro-1,4-dihydroxynaphthalen-2-yl)-2-(7-hydroxy-2,4-dioxochromen-3-ylidene)-2-[(2-pyridin-1-ium-1-ylacetyl)diazenyl]acetamide;chloride 135483951 NSC649826 sensitive
hsa-miR-513c-5p (2s)-n-[(2r)-1-[(2,4-dimethoxyphenyl)methylamino]-1-oxopropan-2-yl]-n-methyl-1-[(2s)-3-methyl-2-[methyl-[(2s)-3-methyl-2-[[(2s)-3-methyl-2-(octanoylamino)butanoyl]amino]butanoyl]amino]butanoyl]pyrroli NSC704971 sensitive
hsa-miR-513c-5p (2Z,5Z)-5-[(4-chlorophenyl)methylidene]-2-[(E)-(3,5-dimethyl-1-phenylpyrazol-4-yl)methylidenehydrazinylidene]-3-phenyl-1,3-thiazolidin-4-one 9572522 NSC720057 resistant
hsa-miR-513c-5p (3e)-5-methoxy-3-(pyridin-4-ylmethylidene)-1h-indol-2-one 24203974 NSC730294 sensitive
hsa-miR-513c-5p (3R,5R,8R,9S,10S,13R,14S,17R)-17-[(2R)-4-(4,5-dihydro-1H-imidazol-2-yl)butan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol 391085 NSC689620 sensitive
hsa-miR-513c-5p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-513c-5p (3z)-3-[(2-chlorophenyl)methylidene]-1-phenylimidazo[1,5-a]benzimidazole 5472492 NSC719480 resistant
hsa-miR-513c-5p (3Z,5Z)-1,1-dimethyl-3,5-bis[(E)-3-phenylprop-2-enylidene]piperidin-1-ium-4-one 6334460 NSC636679 sensitive
hsa-miR-513c-5p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-513c-5p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-513c-5p (4-butanoyloxythieno[2,3-f][1]benzothiol-8-yl) butanoate 388304 NSC682994 sensitive
hsa-miR-513c-5p (4S)-4-hexadecyl-2,6,6-trimethyl-1,3,6,2lambda5-dioxazaphosphocan-6-ium 2-oxide;bromide 386352 NSC678144 resistant
hsa-miR-513c-5p (4S,4aS,5aS,6S,12aR)-4-(dimethylamino)-1,6,10,11,12a-pentahydroxy-6-methyl-3,12-dioxo-N-[[(7-oxo-2,6-dihydrotriazolo[4,5-d]pyrimidin-5-yl)amino]methyl]-4,4a,5,5a-tetrahydrotetracene-2-carboxamide 135422275 NSC67586 sensitive
hsa-miR-513c-5p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-513c-5p (5E)-3-(4-chlorophenyl)-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]-1,3-thiazolidin-4-one 5470241 NSC699069 sensitive
hsa-miR-513c-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-513c-5p (5z)-5-[(2-chlorophenyl)methylidene]-3-(furan-2-ylmethyl)-2-phenylimidazol-4-one 24204861 NSC733164 sensitive
hsa-miR-513c-5p (6-acetamido-5-imino-7-methyl-8-oxo-2,3-dihydro-1h-pyrrolo[1,2-a]benzimidazol-3-yl) 2-methoxyacetate 377193 NSC658420 sensitive
hsa-miR-513c-5p (7,12,13,14-tetraacetyloxy-3,10-dioxo-2,9-dioxatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4,6,8(16),11(15),12-hexaen-6-yl) acetate NSC335995 sensitive
hsa-miR-513c-5p (e)-1-(1,2-dihydroacenaphthylen-5-yl)-3-(4-nitrophenyl)prop-2-en-1-one 6167610 NSC746353 resistant
hsa-miR-513c-5p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-513c-5p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 sensitive
hsa-miR-513c-5p (E)-3-(4-methoxyphenyl)-2-(4-oxo-3H-quinazolin-2-yl)prop-2-enenitrile 135454458 NSC684969 resistant
hsa-miR-513c-5p (E)-3-[4-(dimethylamino)phenyl]-1-(4-hydroxyphenyl)prop-2-en-1-one 5468166 NSC665694 sensitive
hsa-miR-513c-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-513c-5p (z)-(5-bromo-2-oxo-1h-indol-3-ylidene)sulfamic acid 135505239 NSC707054 sensitive
hsa-miR-513c-5p (Z)-1-(4-bromophenyl)-2-(morpholin-4-ylmethyl)-3-phenylprop-2-en-1-one;hydrobromide 24193247 NSC150311 sensitive
hsa-miR-513c-5p (Z)-3-(benzenesulfinyl)-N-benzyl-N-tert-butylprop-2-enamide 5470812 NSC705331 sensitive
hsa-miR-513c-5p (z)-4-bromo-4-iodo-3-phenyl-3-buten-2-one 3004479 NSC657561 sensitive
hsa-miR-513c-5p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-513c-5p [(1e,3e)-4-(benzenesulfonyl)buta-1,3-dienyl]sulfinylbenzene 5468034 NSC662784 sensitive
hsa-miR-513c-5p [(1R)-1-[[(2S)-2-amino-3-naphthalen-1-ylpropanoyl]amino]-3-methylbutyl]boronic acid;hydrochloride 387440 NSC681229 sensitive
hsa-miR-513c-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-513c-5p [(3S,8R,9S,10R,13S,14S,16E,17S)-17-acetyloxy-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-3-yl] acetate 24204032 NSC730473 sensitive
hsa-miR-513c-5p [(8R,9S,13S,14S)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] [(8S,9R,13R,14R)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] sulfite;ethyl acetate 389907 NSC686560 sensitive
hsa-miR-513c-5p [(9e,21z)-28-(1,3-dithiolan-2-yl)-2,29,31-trihydroxy-11-methoxy-3,7,12,14,17,17,20,24,32-nonamethyl-6,25-dioxo-8,16,18,33-tetraoxa-26-azapentacyclo[25.3.1.14,7.115,19.05,30]tritriaconta-1(30),2,4,9,21 54610764 NSC244404 sensitive
hsa-miR-513c-5p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 sensitive
hsa-miR-513c-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 sensitive
hsa-miR-513c-5p [2-(4-methoxyphenyl)-2-oxoethyl] (2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[[(2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[2-(4-methoxyphenyl)-2-oxoethoxy]-3-oxopropyl]diselanyl]propanoate 45029327 NSC746149 resistant
hsa-miR-513c-5p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-palladium; pyridine 135484837 NSC638294 sensitive
hsa-miR-513c-5p [3-(difluoromethyl)-6,7-dimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl]-phenylmethanone 54612713 NSC742327 sensitive
hsa-miR-513c-5p [3-methyl-4-(phenylcarbamothioyl)phenyl] n-(4-chlorophenyl)carbamate 5471249 NSC710002 sensitive
hsa-miR-513c-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-4-phenyl-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 383439 NSC671806 sensitive
hsa-miR-513c-5p [4-(4-aminophenyl)sulfonylphenyl]-[4-(4-aminophenyl)sulfonylphenyl]imino-oxidoazanium 380146 NSC665549 resistant
hsa-miR-513c-5p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(2-thienyl)methanone 399019 NSC709440 resistant
hsa-miR-513c-5p [5-acetamido-4-[1-[[1-[(5-amino-1,5-dioxo-1-phenylmethoxypentan-2-yl)amino]-3-methyl-1-oxobutan-2-yl]amino]-1-oxopropan-2-yl]oxy-3-hydroxyoxan-2-yl]methyl 11-[(1-nitro-9-oxo-10h-acridine-4-carbonyl)am 3774228 NSC642600 resistant
hsa-miR-513c-5p [bis(aminomethyl)diethylsilane]dichloroplatinum (ii) NSC645351 sensitive
hsa-miR-513c-5p [dibutyl-(2,6-difluorobenzoyl)oxy-stannyl] 2,6-difluorobenzoate 16683188 NSC643841 sensitive
hsa-miR-513c-5p {(1r,3s)-3-[(2-amino-6-chloro-9h-purin-9-yl)methyl]-1,2,2-trimethylcyclopentyl}methanol 395604 NSC700349 sensitive
hsa-miR-513c-5p 1-(1,3-benzodioxol-5-yl)-2-[(dimethylamino)methyl]prop-2-en-1-one 436064 NSC382006 sensitive
hsa-miR-513c-5p 1-(4-chloronaphthalen-1-yl)-2-(dimethylamino)ethanol 4-methylbenzenesulfonate(1:1) 230791 NSC26074 sensitive
hsa-miR-513c-5p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 resistant
hsa-miR-513c-5p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 resistant
hsa-miR-513c-5p 1-(6-bromo-2-chloroquinolin-3-yl)-n-(4-chlorophenyl)methanimine 402198 NSC716089 sensitive
hsa-miR-513c-5p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-513c-5p 1-[(E)-1-[4-[methyl(phenyl)sulfamoyl]phenyl]ethylideneamino]-3-propylthiourea 5466445 NSC691415 resistant
hsa-miR-513c-5p 1-[2-(3-chlorophenyl)-2-oxoethyl]-2-acetylbenzimidazole 46911792 NSC748533 sensitive
hsa-miR-513c-5p 1-[4-chloro-3-(trifluoromethyl)phenyl]-2-[4-[2-[di(propan-2-yl)amino]ethylamino]-6-methylpyrimidin-2-yl]guanidine 49791547 NSC127328 sensitive
hsa-miR-513c-5p 1-[5-(4-chlorophenyl)-3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-3,4-dihydropyrazol-2-yl]ethanone 155813083 NSC762545 resistant
hsa-miR-513c-5p 1-[6-[[tert-butyl(dimethyl)silyl]oxymethyl]-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-5-ethynyl-6-iodopyrimidine-2,4-dione 45028651 NSC743558 sensitive
hsa-miR-513c-5p 1-benzyl-2H-imidazol-2-ide;gold(1+) 374564 NSC652538 sensitive
hsa-miR-513c-5p 1-benzyl-3-hexadecyl-2-methylimidazolium chloride 44219704 NSC745343 sensitive
hsa-miR-513c-5p 1-butoxy-4-(dichloromethylidene)-3,5-dimethyl-1,4-dihydrophosphinine 1-oxide 372646 NSC648100 sensitive
hsa-miR-513c-5p 10-nitrosophenanthren-9-ol 95223 NSC48526 sensitive
hsa-miR-513c-5p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 sensitive
hsa-miR-513c-5p 11-(4-nitrophenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608965 NSC697748 sensitive
hsa-miR-513c-5p 11-cyanomethylen-11h-indolo[1,2-a]indazole 5472501 NSC719690 resistant
hsa-miR-513c-5p 13-chloro-11,17-diazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,12,14,16-heptaene-8,9-dione 19610848 NSC742544 sensitive
hsa-miR-513c-5p 13-methoxy-6-methyl-2-nitro-6,9,17-triazatetracyclo[8.7.1.05,18.011,16]octadeca-1,3,5(18),10,12,14,16-heptaene 438699 NSC658995 resistant
hsa-miR-513c-5p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-513c-5p 1h-purine, 6-[(1-methyl-4-nitro-1h-imidazol-5-yl)seleno]- 3879067 NSC252628 sensitive
hsa-miR-513c-5p 2',6'-dibromo-2-(methoxymethyl)spiro[7,8-dihydro-6h-thieno[3,2-g]quinoline-5,4'-cyclohexa-2,5-diene]-1',4,9-trione 375900 NSC656211 sensitive
hsa-miR-513c-5p 2',6'-dibromospiro[7,8-dihydro-6h-pyrido[2,3-g]quinoline-9,4'-cyclohexa-2,5-diene]-1',5,10-trione 383051 NSC671095 sensitive
hsa-miR-513c-5p 2-(1-(4-(2-pyridyl)piperazino))naphthazarin 376947 NSC658142 sensitive
hsa-miR-513c-5p 2-(2-amino-5-chloro-6-phenylpyrimidin-4-yl)-4-chlorophenol 359847 NSC621457 resistant
hsa-miR-513c-5p 2-(2-chloro-5-methyl-pyrimidin-4-yl)-2-(1-methylbenzimidazol-2-yl)acetonitrile 395227 NSC699702 resistant
hsa-miR-513c-5p 2-(2-chloroethoxy)naphthazarin 378770 NSC661940 sensitive
hsa-miR-513c-5p 2-(2-naphthyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 388200 NSC682768 resistant
hsa-miR-513c-5p 2-(2,1,3-benzothiadiazol-4-ylsulfonyl)-1-(4-chlorophenyl)guanidine 9572213 NSC707404 sensitive
hsa-miR-513c-5p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 resistant
hsa-miR-513c-5p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-513c-5p 2-(3-chloropropyloxy)naphthazarin 378771 NSC661941 sensitive
hsa-miR-513c-5p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-513c-5p 2-(3-phenyl-4,5-bis(phenylimino)-1,3-thiazolidin-2-ylidene)malononitrile 383253 NSC671367 sensitive
hsa-miR-513c-5p 2-(3,4-dichlorophenyl)-N-methyl-N-[3-[methyl(3-pyrrolidin-1-ylpropyl)amino]propyl]acetamide;oxalic acid 398603 NSC708559 sensitive
hsa-miR-513c-5p 2-(4-aminobutyl)-1,4-dihydroxyanthracene-9,10-dione;hydrochloride 439019 NSC699139 resistant
hsa-miR-513c-5p 2-(4-chlorophenyl)-1-methylene-3-phenyl-pyrazino[1,2-a]benzimidazole 390230 NSC687522 resistant
hsa-miR-513c-5p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-513c-5p 2-(4-methylphenyl)-5-(2-naphthyl)-1,3,4-oxadiazole 260000 NSC90810 sensitive
hsa-miR-513c-5p 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxamide 24204601 NSC732287 resistant
hsa-miR-513c-5p 2-(5-nitro-2-furyl)prop-2-enamide 381106 NSC667269 sensitive
hsa-miR-513c-5p 2-(6-ethenyl-4-hydroxy-6-methyl-3-methylidene-2-oxo-4,5,7,7a-tetrahydro-3aH-1-benzofuran-7-yl)prop-2-enal 495207 NSC645991 sensitive
hsa-miR-513c-5p 2-(ethoxymethyl)-4,7-dimethoxy-6-[6-(4-methylpiperazin-1-yl)-1h-benzimidazol-2-yl]-1h-benzimidazole 398957 NSC709341 sensitive
hsa-miR-513c-5p 2-[(2e,6e,10e,14z,18e,22e,26e)-3,7,11,15,19,23,27,31-octamethyldotriaconta-2,6,10,14,18,22,26,30-octaenyl]benzene-1,4-diol 5470495 NSC702326 sensitive
hsa-miR-513c-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-513c-5p 2-[(9-amino-5-methylacridine-4-carbonyl)amino]ethyl-dimethyl-[(3-nitrothiophen-2-yl)methyl]azanium;chloride 391705 NSC691249 resistant
hsa-miR-513c-5p 2-[(dimethylamino)methyl]-1-(4-methoxyphenyl)prop-2-en-1-one;hydrochloride 353911 NSC603553 sensitive
hsa-miR-513c-5p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-513c-5p 2-[[4-(2-dimethylaminoethylcarbamoyl)acridin-9-yl]amino]-5-guanidino-pentanoic acid 392354 NSC692638 resistant
hsa-miR-513c-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-513c-5p 2-[[amino-[bis(2-bromoethyl)amino]phosphoryl]oxymethyl]naphthalene-1,4-dione 390536 NSC688023 sensitive
hsa-miR-513c-5p 2-[2-[(E)-benzylideneamino]-6-phenylpyrimidin-4-yl]-4-chlorophenol 135509207 NSC678883 resistant
hsa-miR-513c-5p 2-[2-hydroxyethyl-[2-[(7-methoxy-1-nitroacridin-9-yl)amino]ethyl]amino]ethanol 384247 NSC673793 sensitive
hsa-miR-513c-5p 2-[2-hydroxyethyl-[3-[(2-methoxy-6-nitroacridin-9-yl)amino]propyl]amino]ethanol 384257 NSC673803 sensitive
hsa-miR-513c-5p 2-[4-(fluoro)benzylamino]-3-phenyl-5,7-diaminoquinoxaline 24204261 NSC731131 sensitive
hsa-miR-513c-5p 2-[5-(2,2-dimethyl-1,3-dioxolan-4-yl)-2,2-dimethyl-1,3-dioxolan-4-yl]-6-methoxy-3-nitro-2H-chromene 358300 NSC618261 sensitive
hsa-miR-513c-5p 2-[5-[4-[5-[4-(6-morpholin-4-yl-1H-benzimidazol-2-yl)phenoxy]pentyl]piperazin-1-yl]pentyl]benzo[de]isoquinoline-1,3-dione 44219118 NSC743432 sensitive
hsa-miR-513c-5p 2-acetamido-6-methyl-8-hydroxy-1,4-naphthaquinone 377214 NSC658450 sensitive
hsa-miR-513c-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-513c-5p 2-amino-3-chloronaphthalene-1,4-dione 17748 NSC642009 sensitive
hsa-miR-513c-5p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 sensitive
hsa-miR-513c-5p 2-amino-6-[4-[[4,6-bis(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-4-(4-methoxyphenyl)pyridine-3-carbonitrile 45028694 NSC743853 sensitive
hsa-miR-513c-5p 2-amino-8-fluoro-4,6-dimethyl-3-oxo-1-n,9-n-bis[7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3,10-di(propan-2-yl)-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]phenoxazine-1,9-dicarboxamide 383041 NSC671031 sensitive
hsa-miR-513c-5p 2-amino-n-[4,5-dichloro-2-[[methyl-[(1s,2s)-2-pyrrolidin-1-ylcyclohexyl]amino]methyl]phenyl]acetamide 398349 NSC708073 sensitive
hsa-miR-513c-5p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 resistant
hsa-miR-513c-5p 2-butenoic acid, 3-[(1,3-dihydroxy-2-naphthalenyl)thio]-, ethyl ester, (z)- 5358773 NSC278632 sensitive
hsa-miR-513c-5p 2-chloro-1-[4-(2-chloroacetyl)-2,3-dimethyl-2,3-dihydroquinoxalin-1-yl]ethanone 254760 NSC79304 sensitive
hsa-miR-513c-5p 2-chloro-3-amino-5,8-dihydoxy-1,4-naphthoquinone 377211 NSC658443 sensitive
hsa-miR-513c-5p 2-cyclohepta[b]pyrrol-2-yl-5-methyl-1,2-dihydro-3h-pyrazol-3-one 363757 NSC628949 sensitive
hsa-miR-513c-5p 2-ethenyl estradiol 381026 NSC667049 sensitive
hsa-miR-513c-5p 2-hydroxy-5-(2-methoxybenzyl)-5h-benzo[b]carbazole-6,11-dione 403879 NSC719412 resistant
hsa-miR-513c-5p 2-imino-1,3-diphenyl-5-phenyliminoimidazolidine-4-thione 383285 NSC671399 sensitive
hsa-miR-513c-5p 2-isopropyl-11-oxo-n-[2-(4-phenylpiperazin-1-yl)ethyl]-11h-pyrido[2,1-b]quinazoline-8-carboxamide 353192 NSC600684 sensitive
hsa-miR-513c-5p 2-methoxy-N,N-dimethyl-4-[(E)-2-(3-methyl-1,3-benzothiazol-3-ium-2-yl)ethenyl]aniline;iodide 6518097 NSC662251 sensitive
hsa-miR-513c-5p 2-methyl-4-(4-morpholin-4-ylphenyl)iminobenzo[f][1,3]benzoxazol-9-one 386916 NSC679822 sensitive
hsa-miR-513c-5p 2-methyl-9-[(z)-phenylimino]naphth[2,3-d]oxazol-4-one 373683 NSC650574 sensitive
hsa-miR-513c-5p 2-phenyl-N-[3-[4-[3-[(2-phenylquinoline-4-carbonyl)amino]propyl]piperazin-1-yl]propyl]quinoline-4-carboxamide;hydrochloride 384385 NSC674092 sensitive
hsa-miR-513c-5p 2-tert-butyl-9-(4-fluorophenyl)iminobenzo[f][1,3]benzoxazol-4-one 362345 NSC626030 sensitive
hsa-miR-513c-5p 2,1,3-benzoselanadiazole, nitro-6-(trifluoromethyl)- 362897 NSC627371 sensitive
hsa-miR-513c-5p 2,2'-spirobi[3,6,7,8-tetrahydro-1H-cyclopenta[g]naphthalene]-5,5'-dione 382634 NSC670283 sensitive
hsa-miR-513c-5p 2,2-dibutyl-8-methoxy-1,3,2-benzodioxastannin-4-one 16683129 NSC628564 sensitive
hsa-miR-513c-5p 2,3-dibromo-4-(5-chloro-2-methoxyanilino)-4-oxobutanoic acid 307450 NSC205555 sensitive
hsa-miR-513c-5p 2,3,9,10-tetramethoxy-6,8-dihydro-5h-isoquinolino[2,1-b]isoquinoline-8-carbonitrile 397863 NSC706486 sensitive
hsa-miR-513c-5p 2,5-bis(1-hydroxyethyl)thieno[3,2-f][1]benzothiole-4,8-dione 391376 NSC690433 sensitive
hsa-miR-513c-5p 2,5,9,12-tetrathiabicyclo[11.4.0]heptadeca-1(13),14,16-triene-15,16-dicarbonitrile 387185 NSC680721 resistant
hsa-miR-513c-5p 2,6-bis(ethylaminoacetylamino)-9,10-anthraquinone 355146 NSC608329 resistant
hsa-miR-513c-5p 2,6-diamino-n-[2-[[4-[2-(2,6-diaminohexanoylamino)ethylamino]-9,10-dioxoanthracen-1-yl]amino]ethyl]hexanamide 438922 NSC684438 resistant
hsa-miR-513c-5p 2,6-dimethoxy-4-(7-methyl-6-(1-piperidinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenol 383126 NSC671167 sensitive
hsa-miR-513c-5p 2,6-dimethyl-4-(3-nitrophenyl)-3-n,5-n-bis(4-nitrophenyl)-1,4-dihydropyridine-3,5-dicarboxamide 367764 NSC637703 sensitive
hsa-miR-513c-5p 2,6,13,17-tetrazaheptacyclo[15.12.0.01,25.03,16.05,14.07,12.018,23]nonacosa-3,5,7,9,11,13,15,18(23)-octaene 378784 NSC661960 sensitive
hsa-miR-513c-5p 2,7-bis(1-hydroxyethyl)thieno[2,3-f][1]benzothiole-4,8-dione 388026 NSC682451 sensitive
hsa-miR-513c-5p 296cfo5qf6 386891 NSC679749 sensitive
hsa-miR-513c-5p 2h-1-benzopyran-2-one, 4-(2-benzofuranyl)-7-methoxy- 364364 NSC630375 resistant
hsa-miR-513c-5p 3-(2-(2,4-dimethylphenyl)-2-oxoethylidene)-3,4-dihydro-2(1h)-quinoxalinone 135403092 NSC682571 resistant
hsa-miR-513c-5p 3-(2-fluoro-2,2-dinitro-ethoxy)propane-1,2-diol 388365 NSC683260 sensitive
hsa-miR-513c-5p 3-(3,5-dibromo-4-methoxyphenyl)-2-(3-pyridinyl)acrylonitrile 5467796 NSC659319 resistant
hsa-miR-513c-5p 3-(4-chlorophenoxy)-4-[4-(2-dimethylaminoethyloxy)phenyl]-7-methoxy-chromen-2-one 395152 NSC699452 sensitive
hsa-miR-513c-5p 3-(4-fluorophenyl)-3-(4-acetoxy-2-methylphenyl)phthalide 383342 NSC671456 resistant
hsa-miR-513c-5p 3-(4-fluorophenyl)-3-(4-hydroxy-2-methylphenyl)phthalide 387973 NSC682335 resistant
hsa-miR-513c-5p 3-(4-fluorophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388534 NSC683516 sensitive
hsa-miR-513c-5p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-513c-5p 3-[(e)-carbazol-9-yliminomethyl]-4-hydroxy-5-methoxybenzaldehyde 135436314 NSC718153 sensitive
hsa-miR-513c-5p 3-[[4-(3,4-dihydroxyphenyl)-1,3-thiazol-2-yl]iminomethyl]-4-hydroxychromen-2-one;hydrochloride 135403636 NSC659390 sensitive
hsa-miR-513c-5p 3-[5-[2-[2-(4,4-dimethyl-1,1-dioxo-1,2,5-thiadiazolidin-2-yl)ethylamino]pyrimidin-4-yl]imidazo[2,1-b][1,3]thiazol-6-yl]phenol 138631879 NSC761584 sensitive
hsa-miR-513c-5p 3-3'-(1h-pyrazole-3,5-diyl)bis(1-methyl-1h-indole) 44433919 NSC740345 resistant
hsa-miR-513c-5p 3-chloro-4-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride;ethanesulfonic acid 278058 NSC127157 sensitive
hsa-miR-513c-5p 3-chloroindolo[2,1-b]quinazoline-6,12-dione 396706 NSC703315 sensitive
hsa-miR-513c-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 resistant
hsa-miR-513c-5p 3-methyl-4-[(e)-(5-nitrofuran-2-yl)methylideneamino]-1h-1,2,4-triazol-5-one 9556348 NSC698057 sensitive
hsa-miR-513c-5p 3-methyl-5-[(2,3,4,5,6-pentafluorophenyl)-[2,3,5,6-tetrafluoro-4-[(3-methyl-1,2-oxazol-5-yl)methyl]phenyl]methyl]-1,2-oxazole 380224 NSC665700 sensitive
hsa-miR-513c-5p 3-n,6-n,2,7-tetramethylacridine-3,6-diamine;hydrochloride 54608353 NSC32967 resistant
hsa-miR-513c-5p 3,4-dichlorocoumarin 282447 NSC135925 sensitive
hsa-miR-513c-5p 3,5-bis(methylsulfanyl)dithiol-1-ium-4-olate 362515 NSC626539 sensitive
hsa-miR-513c-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-513c-5p 4-((2,2-dibutyl-1,3,2-dioxastannolan-4-yl)methyl)morpholine NSC633511 sensitive
hsa-miR-513c-5p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 sensitive
hsa-miR-513c-5p 4-(3-thioxodithiol-4-yl)-5,6-dihydrodithiolo[5,4-b][1,4]thiazine-3-thione 398473 NSC708376 resistant
hsa-miR-513c-5p 4-(4-chlorophenyl)-N-(2-methoxyphenyl)-3-prop-2-enyl-1,3-thiazol-2-imine;hydrobromide 396119 NSC701666 sensitive
hsa-miR-513c-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 resistant
hsa-miR-513c-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(2-methoxyphenyl)benzamide 1194947 NSC732826 sensitive
hsa-miR-513c-5p 4-[(2Z)-2-[1-amino-3-(methylamino)-1,3-bis(sulfanylidene)propan-2-ylidene]hydrazinyl]-1H-imidazole-5-carboxamide 5466293 NSC684046 sensitive
hsa-miR-513c-5p 4-[(4-methyl-1,2-oxazol-5-yl)amino]naphthalene-1,2-dione 384244 NSC673785 sensitive
hsa-miR-513c-5p 4-[(5-methyl-1,2-oxazol-3-yl)amino]naphthalene-1,2-dione 384243 NSC673784 sensitive
hsa-miR-513c-5p 4-[(6-chloro-4h-1,3-benzodioxin-8-yl)methylsulfanyl]pyrrolo[1,2-a]quinoxaline 331156 NSC321491 resistant
hsa-miR-513c-5p 4-[(E)-(4-nitrophenyl)methylideneamino]-3-phenyl-1H-1,2,4-triazol-5-one 9571512 NSC675223 resistant
hsa-miR-513c-5p 4-[(E)-2-(dimethylamino)ethenyl]benzo[g]quinoline-5,10-dione 5469342 NSC686556 sensitive
hsa-miR-513c-5p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 sensitive
hsa-miR-513c-5p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 sensitive
hsa-miR-513c-5p 4-[2-(3-aminopropylamino)ethyldisulfanyl]butane-1-sulfinic acid;hydrochloride 361203 NSC624166 sensitive
hsa-miR-513c-5p 4-[2-[4-[3-(4-methoxyphenyl)-1-methylene-pyrazino[1,2-a]benzimidazol-2-yl]phenoxy]ethyl]morpholine 399071 NSC709482 sensitive
hsa-miR-513c-5p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 sensitive
hsa-miR-513c-5p 4-acetylspiro[1,3,5,6,7,8-hexahydrocyclopenta[b]naphthalene-2,2'-3,6,7,8-tetrahydro-1h-cyclopenta[g]naphthalene]-5'-one 382750 NSC670428 sensitive
hsa-miR-513c-5p 4-amino-1,3-dibromophenanthridin-6(5h)-one 278033 NSC127128 resistant
hsa-miR-513c-5p 4-benzylidene-1,7-dimorpholin-4-ylheptane-3,5-dione;hydrochloride NSC617824 sensitive
hsa-miR-513c-5p 4-methoxy-2-nitronaphtho[2,1-b]furan 100603 NSC329226 sensitive
hsa-miR-513c-5p 4-methyl-1-oxido-1,2,4-benzotriazin-1-ium-3-imine 360889 NSC623599 sensitive
hsa-miR-513c-5p 4-methyl-1,1-diphenyl-1,2,3,4-tetrahydrobenzo(h)phosphinolinium hexafluorophosphate 498151 NSC245398 sensitive
hsa-miR-513c-5p 4-methyl-n'-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]benzenesulfonohydrazide 381384 NSC667924 sensitive
hsa-miR-513c-5p 4-n-(7-chloroquinolin-4-yl)-1-n-cyclohexylcyclohexane-1,4-diamine NSC3618 sensitive
hsa-miR-513c-5p 4-n-[12-[(5-amino-6-chloropyrimidin-4-yl)amino]dodecyl]-6-chloropyrimidine-4,5-diamine 358989 NSC619196 sensitive
hsa-miR-513c-5p 4,6,6-trimethyl-4-[(e)-4-phenylsulfanylbut-1-enyl]norpinan-2-one 5469503 NSC689222 sensitive
hsa-miR-513c-5p 4,8-dioxothieno[3,2-f][1]benzothiole-2-carboxylic acid 375906 NSC656243 sensitive
hsa-miR-513c-5p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 sensitive
hsa-miR-513c-5p 5-(1,2-benzisothiazol-3-yl)-n-(4-methoxyphenyl)-1,3,4-thiadiazol-2-amine 374732 NSC652924 resistant
hsa-miR-513c-5p 5-(2,4-dichlorobenzyl)-2-hydroxy-5h-benzo[b]carbazole-6,11-dione 403882 NSC719415 resistant
hsa-miR-513c-5p 5-(3-phenyl-3-oxo-1-propynyl)pyrimidine-2,4(1h,3h)-dione 359098 NSC619674 sensitive
hsa-miR-513c-5p 5-(phenyldisulfanyl)pentane-1-sulfinic acid 361236 NSC624191 sensitive
hsa-miR-513c-5p 5-[(E)-3-[4-(diethylamino)phenyl]prop-2-enylidene]-2-sulfanylidene-1,3-diazinane-4,6-dione 6376062 NSC684567 sensitive
hsa-miR-513c-5p 5-amino-10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2(7),3,5,8,11(19),12,14(18)-heptaene-15,17-dione 399633 NSC710550 resistant
hsa-miR-513c-5p 5-benzyl-4-imino-6-methyl-n-phenyl-7h-pyrrolo[2,3-d]pyrimidin-3-amine 135426658 NSC706031 sensitive
hsa-miR-513c-5p 5-bromo-3h-triazolo[4,5-d]pyrimidin-7-ol 135440019 NSC680827 sensitive
hsa-miR-513c-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-513c-5p 5,6,11,12-tetramethyl-5,5a,6,11,11a,12-hexahydroquinoxalino[2,3-b]quinoxaline 365519 NSC633207 sensitive
hsa-miR-513c-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 sensitive
hsa-miR-513c-5p 6-(1,3-benzodioxol-5-yl)-8-(4-chlorophenyl)-8,9-dihydro-7h-pyrimido[4,5-b][1,4]diazepin-4-amine 25110635 NSC743962 resistant
hsa-miR-513c-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 resistant
hsa-miR-513c-5p 6-[(1-hydroxy-1-phenylpropan-2-yl)amino]quinoline-5,8-dione 386228 NSC677945 sensitive
hsa-miR-513c-5p 6-[3-[4-(3-aminopropoxy)butoxy]propyl]-13-[3-[(2-methoxyphenyl)methylamino]propyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 137647086 NSC760980 sensitive
hsa-miR-513c-5p 6-[3-[4-(3-aminopropylamino)butylamino]propyl]-13-[3-[(2-methoxyphenyl)methylamino]propyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 137655794 NSC757981 sensitive
hsa-miR-513c-5p 6-amino-9-methoxyisoindolo[2,1-a]quinoxalin-3-ol 60147951 NSC753218 sensitive
hsa-miR-513c-5p 6-bromo-2-methyl-3-[4-[(3,4,5-trihydroxyoxan-2-yl)amino]phenyl]quinazolin-4-one 380114 NSC665514 sensitive
hsa-miR-513c-5p 6-bromo-2,10-dithiatetracyclo[10.8.0.04,9.014,19]icosa-1(20),4(9),5,7,12,14,16,18-octaene-3,11-dione 397767 NSC706190 sensitive
hsa-miR-513c-5p 6-bromochroman-2-one 266737 NSC105509 resistant
hsa-miR-513c-5p 6-chloro-1,2,3-benzodithiazol-1-ium;chloride 359816 NSC621376 sensitive
hsa-miR-513c-5p 6-methoxynaphthazarin 377431 NSC658874 sensitive
hsa-miR-513c-5p 6-phenyl-6h-indeno[1,2-c]isoquinoline-5,11-dione 334247 NSC338643 resistant
hsa-miR-513c-5p 6,9-dihydroxybenzo[g]isoquinoline-5,10-dione 431317 NSC291926 sensitive
hsa-miR-513c-5p 6h-indeno[1,2-c]isoquinoline-5,11-dione, 6-methyl- 265730 NSC102067 resistant
hsa-miR-513c-5p 7-chloro-10,11-dimethoxy-2,8-diazatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene-3,4-dione 397794 NSC706232 sensitive
hsa-miR-513c-5p 7-chloro-6-(2-morpholin-4-ylethylamino)quinoline-5,8-dione 379078 NSC663285 sensitive
hsa-miR-513c-5p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 sensitive
hsa-miR-513c-5p 7-chloro-n-[2-[2-[(7-chloro-1-methylbenzo[g]indole-3-carbonyl)amino]ethyl-methylamino]ethyl]-1-methylbenzo[g]indole-3-carboxamide 397209 NSC704618 resistant
hsa-miR-513c-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-513c-5p 7h-5,6-dithioleno[4,3-d]uracil 388876 NSC684074 sensitive
hsa-miR-513c-5p 8-aminoquinoline-5,6-dione 279596 NSC130785 sensitive
hsa-miR-513c-5p 8-azaguanine 8646 NSC749 sensitive
hsa-miR-513c-5p 8-chloro-10-(4-chlorophenyl)-3-methylbenzo[g]pteridine-2,4-dione 363245 NSC627991 sensitive
hsa-miR-513c-5p 8-chloro-n-[2-(dimethylamino)ethyl]-11h-pyrido[2,3-a]carbazole-5-carboxamide 44139299 NSC741237 sensitive
hsa-miR-513c-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-513c-5p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 sensitive
hsa-miR-513c-5p 9-amino-7-(3,4,5-trimethoxyphenyl)-6h-benzo[c]chromene-8,10-dicarbonitrile 399086 NSC709502 resistant
hsa-miR-513c-5p 9-amino-N-[3-(2-aminoethylamino)propyl]-5-methylacridine-4-carboxamide;hydrochloride 392737 NSC693543 resistant
hsa-miR-513c-5p 9-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386894 NSC679796 sensitive
hsa-miR-513c-5p 9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-(3-oxoprop-1-en-2-yl)-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid 22149181 NSC750324 sensitive
hsa-miR-513c-5p 9,10-dimethyltricyclo[10.4.0.02,7]hexadeca-1(16),2,4,6,12,14-hexaene-4,5,14,15-tetrol 382047 NSC669349 sensitive
hsa-miR-513c-5p 9,14-dihydroxy-16-methyl-2,11-dioxo-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-17-carbonitrile 405342 NSC722565 sensitive
hsa-miR-513c-5p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 sensitive
hsa-miR-513c-5p Ac-907/25004561 6405305 NSC64798 sensitive
hsa-miR-513c-5p Acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) 281604 NSC134459 sensitive
hsa-miR-513c-5p Acetic acid;4-(2-aminocyclohexyl)imino-2-methylbenzo[f][1,3]benzoxazol-9-one 388014 NSC682436 sensitive
hsa-miR-513c-5p Acetoxy-[4-(acetoxymercurio)-2,5-dimethoxy-3-(3-oxobutanoylamino)phenyl]mercury 16683868 NSC635979 sensitive
hsa-miR-513c-5p Acronycine, 2-nitro 342903 NSC380856 sensitive
hsa-miR-513c-5p Actinomycin x4357g methoxime 9573583 NSC237671 sensitive
hsa-miR-513c-5p Ae 200 NSC22709 sensitive
hsa-miR-513c-5p Albb-024793 221765 NSC6777 resistant
hsa-miR-513c-5p Antineoplastic-615538 NSC615538 sensitive
hsa-miR-513c-5p Antineoplastic-655901 375754 NSC655901 sensitive
hsa-miR-513c-5p Antineoplastic-690266 5469577 NSC690266 sensitive
hsa-miR-513c-5p Aquamycin 10971 NSC38643 sensitive
hsa-miR-513c-5p Auranofin 6333901 NSC321521 sensitive
hsa-miR-513c-5p Aza-heterocyclic derivative, 4c 387030 NSC680350 sensitive
hsa-miR-513c-5p B676297k277 3',4'-deoxypsorospermin 3',4'-chlorohydrin 354175 NSC605099 sensitive
hsa-miR-513c-5p Benzene, 1,1'-[(1,3-butadiene-1,4-diyl)sulfonyl]bis 5468033 NSC662781 sensitive
hsa-miR-513c-5p Benzenesulfonamide, m-(4-amino-3-methoxy-1-naphthylazo)- 248466 NSC65537 sensitive
hsa-miR-513c-5p Benzo[1,2-b:4,5-b']dithiophene-4,8-diol, dipropionate 388303 NSC682993 sensitive
hsa-miR-513c-5p Benzo[1,2-b:5,4-b']dithiophene-4,8-dione, 2-acetyl- 388028 NSC682453 sensitive
hsa-miR-513c-5p Benzo[1,2-c:4,5-c']dipyrrole-1,3,5,7(2h,6h)-tetraimine 359178 NSC619860 sensitive
hsa-miR-513c-5p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 sensitive
hsa-miR-513c-5p Benzyl-(1-methyltetrazol-5-yl)azanide;gold(1+);triphenylphosphanium 6333602 NSC274553 sensitive
hsa-miR-513c-5p Benzyl 4-oxo-4-[[2-oxo-2-propan-2-yloxy-1-[(2,2,5,5-tetramethylcyclopentanecarbonyl)amino]ethyl]amino]-3-(phenylmethoxycarbonylamino)butanoate 383829 NSC672446 resistant
hsa-miR-513c-5p Bis(helenalinyl)glutarate 336831 NSC352330 sensitive
hsa-miR-513c-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-513c-5p Blastmycin 245869 NSC58239 sensitive
hsa-miR-513c-5p Bn-2629 393111 NSC694501 sensitive
hsa-miR-513c-5p Bortezomib 387447 NSC681239 approved sensitive
hsa-miR-513c-5p Bulleyanin 338942 NSC363787 sensitive
hsa-miR-513c-5p Butanedioic acid;10-[3-(4-methylpiperazin-1-yl)propyl]-2-(trifluoromethyl)phenothiazine 5351168 NSC46061 sensitive
hsa-miR-513c-5p C8, carbonyl prodigiosine 135540857 NSC742417 sensitive
hsa-miR-513c-5p Caracemide 54747 NSC253272 sensitive
hsa-miR-513c-5p Carbon monoxide;1-[(4-cyanophenyl)iminomethyl]naphthalen-2-olate;iridium 6711631 NSC632882 sensitive
hsa-miR-513c-5p Carquniostatin b 380452 NSC666034 sensitive
hsa-miR-513c-5p Cbmicro_021216 812842 NSC707055 sensitive
hsa-miR-513c-5p Cepharanthine 10206 NSC758965 sensitive
hsa-miR-513c-5p Chapliatrin 5458480 NSC249956 sensitive
hsa-miR-513c-5p Chemdiv3_000672 397122 NSC704435 resistant
hsa-miR-513c-5p Chimaphilin 101211 NSC400245 sensitive
hsa-miR-513c-5p Chinon 95715 NSC30706 sensitive
hsa-miR-513c-5p Chloroplatinum(1+); 2-diphenylphosphanyl-n,n-dimethyl-ethanamine 499568 NSC685470 sensitive
hsa-miR-513c-5p Chonemorphine 54612857 NSC748909 sensitive
hsa-miR-513c-5p Cisplatin 5460033 NSC119875 approved sensitive
hsa-miR-513c-5p Clothixamide maleate 44144400 NSC78714 sensitive
hsa-miR-513c-5p Copper;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578854 NSC633271 sensitive
hsa-miR-513c-5p Coptisine chloride 72321 NSC119754 sensitive
hsa-miR-513c-5p Crotoxin cd NSC636009 sensitive
hsa-miR-513c-5p Cyclopentane; dichloro(dichloroferriooxy)iron; dichloroiron 498236 NSC608972 sensitive
hsa-miR-513c-5p Cytochalasin h 5351303 NSC305222 resistant
hsa-miR-513c-5p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-513c-5p Dasatinib 3062316 NSC732517 approved resistant
hsa-miR-513c-5p Dasatinib 3062316 NSC732517 approved resistant
hsa-miR-513c-5p Destruxin a 122810 NSC361126 sensitive
hsa-miR-513c-5p Destruxin b NSC236580 sensitive
hsa-miR-513c-5p Destruxin e 107863 NSC361127 sensitive
hsa-miR-513c-5p Di-p-tolyliodinium bromide 54601177 NSC8985 sensitive
hsa-miR-513c-5p Dibutyl-bis(4,5-dihydrothiazol-2-ylsulfanyl)stannane 9571331 NSC643864 sensitive
hsa-miR-513c-5p Dibutyl(bis((3-(2-fluorophenyl)acryloyl)oxy))stannane 16683204 NSC643860 sensitive
hsa-miR-513c-5p Dichloro(diphenyl)stannane;1,4,7,10,13,16-hexaoxacyclooctadecane 338856 NSC363143 sensitive
hsa-miR-513c-5p Dichloroallyl lawsone 277767 NSC126771 sensitive
hsa-miR-513c-5p Diethyl 2-((4-(((3-chloro-2-phenyl-6-quinoxalinyl)methyl)amino)benzoyl)amino)pentanedioate 373186 NSC649150 sensitive
hsa-miR-513c-5p Diethyl 2-[[4-(5,7-diamino-3-phenylquinoxalin-2-yl)oxybenzoyl]amino]pentanedioate 405952 NSC723741 sensitive
hsa-miR-513c-5p Diethyl 2-[[4-[(3-ethoxycarbonylquinoxalin-2-yl)amino]benzoyl]amino]pentanedioate 382848 NSC670678 resistant