miRTarBase - #MIRT560685


—
pre-miRNA Information
pre-miRNA hsa-mir-23a   
Genomic Coordinates chr19: 13836587 - 13836659
Synonyms MIRN23A, hsa-mir-23a, miRNA23A, MIR23A
Description Homo sapiens miR-23a stem-loop
Comment This miRNA was previously named miR-23 . This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-23a-5p
Sequence 9| GGGGUUCCUGGGGAUGGGAUUU |30
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs748509260 12 dbSNP
rs1205403719 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HIST1H1T   
Synonyms H1.6, H1FT, H1t, dJ221C16.2
Description histone cluster 1 H1 family member t
Transcript NM_005323   
Expression
Putative miRNA Targets on HIST1H1T
3'UTR of HIST1H1T
(miRNA target sites are highlighted)		 
>HIST1H1T|NM_005323|3'UTR
   1 AGAGCTTTCCGGGAGGCCAATTTGGAAAGAACCCAAAGGCTCTTTTAAGAGCCACCCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuuaggguaggggucCUUGGGg 5'
                         |||||| 
Target 5' aggccaatttggaaaGAACCCa 3'
 14 - 35 120.00 -11.70
2 
miRNA  3' uuUAGGGU-----AGGGG----UCCUUGGGg 5'
            | ||||     ||:::    ||  |||| 
Target 5' agAACCCAAAGGCTCTTTTAAGAGCCACCCa 3'
 28 - 58 86.00 -20.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN508605 10 COSMIC
COSN14213272 11 COSMIC
COSN20087031 15 COSMIC
COSN30146971 16 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774650055 2 dbSNP
rs559224129 3 dbSNP
rs768823252 4 dbSNP
rs367916003 5 dbSNP
rs370226144 6 dbSNP
rs769527164 7 dbSNP
rs745834882 10 dbSNP
rs781039123 11 dbSNP
rs371920374 15 dbSNP
rs1354495638 16 dbSNP
rs945389329 18 dbSNP
rs1407483303 19 dbSNP
rs1361302586 20 dbSNP
rs200812561 21 dbSNP
rs747076878 21 dbSNP
rs777333384 24 dbSNP
rs201558475 28 dbSNP
rs377258621 29 dbSNP
rs938079458 31 dbSNP
rs1262222662 32 dbSNP
rs766873739 34 dbSNP
rs1365872756 35 dbSNP
rs1052146780 36 dbSNP
rs1176880169 37 dbSNP
rs1457340698 38 dbSNP
rs761084478 40 dbSNP
rs913611501 43 dbSNP
rs1210540830 47 dbSNP
rs1313803476 47 dbSNP
rs1262133855 54 dbSNP
rs1459648079 55 dbSNP
rs1319819767 57 dbSNP
rs927179243 58 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uuuaggguagggguccuuGGGg 5'
                            ||| 
Target 5' ------------------CCCa 3'
 		1 - 4
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000338379.4 | 3UTR | CCCAAAGGCUCUUUUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000338379.4 | 3UTR | CCCAAAGGCUCUUUUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.495 1.3e-2 0.620 1.8e-3 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.317 8.7e-2 -0.316 8.7e-2 20 Click to see details
GSE19350 CNS germ cell tumors -0.384 1.1e-1 -0.222 2.4e-1 12 Click to see details
GSE28544 Breast cancer -0.229 1.4e-1 -0.182 2.0e-1 24 Click to see details
GSE19783 ER- ER- breast cancer 0.116 1.5e-1 0.235 1.9e-2 79 Click to see details
GSE32688 Pancreatic cancer 0.161 1.9e-1 0.232 1.0e-1 32 Click to see details
GSE21687 Ependynoma primary tumors -0.111 1.9e-1 -0.135 1.4e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.151 2.4e-1 -0.230 1.3e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.123 2.8e-1 0.084 3.5e-1 24 Click to see details
GSE21032 Prostate cancer 0.049 3.3e-1 0.024 4.1e-1 83 Click to see details
GSE28260 Renal cortex and medulla -0.121 3.5e-1 -0.104 3.7e-1 13 Click to see details
GSE38226 Liver fibrosis 0.091 3.5e-1 -0.160 2.4e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.15 3.5e-1 0.100 4.0e-1 9 Click to see details
GSE19536 Breast cancer -0.034 3.7e-1 0.014 4.5e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.049 4.1e-1 -0.008 4.8e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.235 0.02 0.317 0 78 Click to see details
LUSC 0.258 0.06 0.305 0.03 38 Click to see details
PCPG 0.949 0.1 1.000 0.5 3 Click to see details
LUAD 0.385 0.15 0.350 0.18 9 Click to see details
LIHC 0.167 0.16 0.220 0.09 38 Click to see details
PRAD -0.215 0.19 0.007 0.49 19 Click to see details
STAD 0.153 0.22 0.302 0.06 28 Click to see details
KICH -0.149 0.27 -0.120 0.31 20 Click to see details
UCEC -0.143 0.28 -0.013 0.48 19 Click to see details
ESCA -0.141 0.34 -0.070 0.42 11 Click to see details
THCA 0.045 0.37 0.038 0.39 59 Click to see details
BLCA -0.09 0.37 0.124 0.32 16 Click to see details
PAAD -0.258 0.37 0.200 0.4 4 Click to see details
KIRP 0.04 0.41 0.046 0.4 32 Click to see details
KIRC -0.022 0.43 0.040 0.38 62 Click to see details
CHOL 0.071 0.43 0.452 0.13 8 Click to see details
CESC -0.131 0.46 0.125 0.46 3 Click to see details
HNSC 0.011 0.47 -0.185 0.13 40 Click to see details
HNSC 0.011 0.47 -0.185 0.13 40 Click to see details
HNSC 0.011 0.47 -0.185 0.13 40 Click to see details
HNSC 0.011 0.47 -0.185 0.13 40 Click to see details
131 hsa-miR-23a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038958 ATF1 activating transcription factor 1 1 1
MIRT057661 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT395438 NFKBID NFKB inhibitor delta 2 2
MIRT463884 WNT7B Wnt family member 7B 2 4
MIRT475804 HDGF heparin binding growth factor 2 2
MIRT478528 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT479278 CHD4 chromodomain helicase DNA binding protein 4 2 6
MIRT492564 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT500353 ZNF385A zinc finger protein 385A 2 2
MIRT509788 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT511566 HIST3H2BB histone cluster 3 H2B family member b 2 4
MIRT525450 GPATCH2L G-patch domain containing 2 like 2 2
MIRT539558 CNKSR3 CNKSR family member 3 2 4
MIRT540034 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT540225 SAMD5 sterile alpha motif domain containing 5 2 2
MIRT540242 RGS17 regulator of G protein signaling 17 2 2
MIRT540871 ZBTB24 zinc finger and BTB domain containing 24 2 2
MIRT559065 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT560685 HIST1H1T histone cluster 1 H1 family member t 2 2
MIRT565593 SLC35G1 solute carrier family 35 member G1 2 2
MIRT565642 SKI SKI proto-oncogene 2 2
MIRT576747 Tmem127 transmembrane protein 127 2 2
MIRT607712 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT615682 NAV2 neuron navigator 2 2 2
MIRT617337 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT617378 FAM227A family with sequence similarity 227 member A 2 2
MIRT620855 SERPING1 serpin family G member 1 2 2
MIRT625112 SLC1A5 solute carrier family 1 member 5 2 2
MIRT625124 NUP93 nucleoporin 93 2 2
MIRT625898 LINC00632 long intergenic non-protein coding RNA 632 2 2
MIRT626016 XRCC2 X-ray repair cross complementing 2 2 2
MIRT626481 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT626573 MED7 mediator complex subunit 7 2 2
MIRT626814 PRR11 proline rich 11 2 2
MIRT628136 HM13 histocompatibility minor 13 2 2
MIRT630771 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT633133 C6orf132 chromosome 6 open reading frame 132 2 2
MIRT636950 APTX aprataxin 2 2
MIRT637802 GGPS1 geranylgeranyl diphosphate synthase 1 2 2
MIRT638622 GSR glutathione-disulfide reductase 2 4
MIRT642196 SMAGP small cell adhesion glycoprotein 2 2
MIRT645121 HES2 hes family bHLH transcription factor 2 2 2
MIRT645344 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT646564 ALDH5A1 aldehyde dehydrogenase 5 family member A1 2 2
MIRT649243 TRIM65 tripartite motif containing 65 2 2
MIRT651810 USP49 ubiquitin specific peptidase 49 2 2
MIRT652137 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT652668 TIMELESS timeless circadian clock 2 2
MIRT655894 NEK9 NIMA related kinase 9 2 2
MIRT656564 LYRM7 LYR motif containing 7 2 2
MIRT657194 IKZF3 IKAROS family zinc finger 3 2 2
MIRT657907 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT660207 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT660619 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT660826 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT660986 ABHD2 abhydrolase domain containing 2 2 2
MIRT662232 PGBD4 piggyBac transposable element derived 4 2 2
MIRT663691 ZNF347 zinc finger protein 347 2 2
MIRT665577 TUBD1 tubulin delta 1 2 2
MIRT666149 SP2 Sp2 transcription factor 2 2
MIRT666310 SLC22A3 solute carrier family 22 member 3 2 2
MIRT666457 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT667716 KIAA1468 KIAA1468 2 2
MIRT668329 FKBP5 FK506 binding protein 5 2 2
MIRT668370 FBXO47 F-box protein 47 2 2
MIRT669304 C17orf75 chromosome 17 open reading frame 75 2 2
MIRT669538 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT671681 ADK adenosine kinase 2 2
MIRT672177 MRE11A MRE11 homolog, double strand break repair nuclease 2 2
MIRT673604 HPSE heparanase 2 2
MIRT673749 ZNF333 zinc finger protein 333 2 2
MIRT674807 FAM229B family with sequence similarity 229 member B 2 2
MIRT675286 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT675391 SVOP SV2 related protein 2 2
MIRT675788 MED28 mediator complex subunit 28 2 2
MIRT676151 OGFOD1 2-oxoglutarate and iron dependent oxygenase domain containing 1 2 2
MIRT676499 GJD3 gap junction protein delta 3 2 2
MIRT676621 CSNK1E casein kinase 1 epsilon 2 2
MIRT676644 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT676711 METTL14 methyltransferase like 14 2 2
MIRT676809 SHROOM4 shroom family member 4 2 2
MIRT677036 FOXO3 forkhead box O3 2 2
MIRT677062 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT677086 SMIM15 small integral membrane protein 15 2 2
MIRT677193 MURC caveolae associated protein 4 2 2
MIRT677273 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT677345 POC1A POC1 centriolar protein A 2 2
MIRT677504 SLC10A6 solute carrier family 10 member 6 2 2
MIRT677526 OCIAD2 OCIA domain containing 2 2 2
MIRT677661 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT677727 SSR1 signal sequence receptor subunit 1 2 2
MIRT677803 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT678144 SLC4A4 solute carrier family 4 member 4 2 2
MIRT678376 VTA1 vesicle trafficking 1 2 2
MIRT678708 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT678868 FAM118A family with sequence similarity 118 member A 2 2
MIRT679039 LACTB lactamase beta 2 2
MIRT679081 PURB purine rich element binding protein B 2 2
MIRT679137 SYK spleen associated tyrosine kinase 2 2
MIRT679299 SSBP2 single stranded DNA binding protein 2 2 2
MIRT679741 CABP4 calcium binding protein 4 2 2
MIRT679946 AS3MT arsenite methyltransferase 2 2
MIRT679976 E2F2 E2F transcription factor 2 2 2
MIRT683628 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT683901 PSMB9 proteasome subunit beta 9 2 2
MIRT684172 MOG myelin oligodendrocyte glycoprotein 2 2
MIRT684231 C20orf144 chromosome 20 open reading frame 144 2 2
MIRT685403 C1orf158 chromosome 1 open reading frame 158 2 2
MIRT686253 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT687513 NCKAP1 NCK associated protein 1 2 2
MIRT688243 FITM2 fat storage inducing transmembrane protein 2 2 2
MIRT688315 FAM151B family with sequence similarity 151 member B 2 2
MIRT688733 CNDP1 carnosine dipeptidase 1 2 2
MIRT689031 ANGPTL3 angiopoietin like 3 2 2
MIRT698207 TMEM248 transmembrane protein 248 2 2
MIRT699859 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT709954 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT711541 MSH3 mutS homolog 3 2 2
MIRT712077 WDR37 WD repeat domain 37 2 2
MIRT715312 POLR2E RNA polymerase II subunit E 2 2
MIRT715725 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT715748 HSD11B1L hydroxysteroid 11-beta dehydrogenase 1 like 2 2
MIRT717604 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT717875 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT718042 NIPAL2 NIPA like domain containing 2 2 2
MIRT718829 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT724037 CAMK2N2 calcium/calmodulin dependent protein kinase II inhibitor 2 2 2
MIRT733305 TNF tumor necrosis factor 1 0
MIRT734941 HSPA1B heat shock protein family A (Hsp70) member 1B 3 0
MIRT737343 IGF2 insulin like growth factor 2 3 0
MIRT737546 PTEN phosphatase and tensin homolog 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-23a 1'-Acetoxychavicol acetate (ACA) NULL 119104 Microarray HN4 cell line 24317043 2014 down-regulated
miR-23a 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 up-regulated
miR-23a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 up-regulated
miR-23a Enoxacin approved 3229 Quantitative real-time PCR HEK293 cells 18641635 2008 up-regulated
miR-23a 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR endometrial stromal 19088369 2008 down-regulated
miR-23a 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR glandular epithelial cells 19088369 2008 down-regulated
miR-23a Medroxyprogesterone acetate approved 6279 Quantitative real-time PCR endometrial stromal 19088369 2008 down-regulated
miR-23a Medroxyprogesterone acetate approved 6279 Quantitative real-time PCR glandular epithelial cells 19088369 2008 up-regulated
miR-23a 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
miR-23a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-23a Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-23a Bio-Oss NULL NULL Microarray osteoblast-like cell line (MG63) 20224834 2010 up-regulated
miR-23a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-23a 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-23a Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-23a Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-23a 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Quantitative real-time PCR thymus 23024791 2012 down-regulated
miR-23a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-23a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-23a Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 up-regualted
miR-23a Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-23a Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miR-23a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-23a Ethanol NULL 702 Quantitative real-time PCR zebrafish embryos 22298809 2012 down-regulated
miR-23a 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 up-regulated
miR-23a 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 up-regulated
miR-23a Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC-7901)
hsa-mir-23a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-mir-23a Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-23a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive cell line (OE19)
hsa-mir-23a Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-23a Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive cell line (SGC-7901)
hsa-miR-23a-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-23a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-23a-5p Palbociclib 5330286 NSC758247 approved resistant High Breast Cancer cell line (T47D)
hsa-miR-23a-5p Arsenic trioxide 261004 NSC759274 approved sensitive Low Acute Myeloid Leukemia cell line (U937, Kasumi-1, THP-1, Jurkat E6.1, SUP B15)
hsa-miR-23a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-23a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-23a-5p Tripterygium wilfordii Hook F resistant tissue
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-23a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-23a-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-23a-5p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-23a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-23a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-23a-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-23a-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-23a-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-23a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (MDA-231)
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-23a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-23a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-23a-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission